Incidental Mutation 'R6791:Olfr312'
ID532602
Institutional Source Beutler Lab
Gene Symbol Olfr312
Ensembl Gene ENSMUSG00000096806
Gene Nameolfactory receptor 312
SynonymsGA_x6K02T2NKPP-575829-574903, MOR222-4P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R6791 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58829237-58834780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58832077 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 308 (Y308H)
Ref Sequence ENSEMBL: ENSMUSP00000149697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078217] [ENSMUST00000216407]
Predicted Effect probably benign
Transcript: ENSMUST00000078217
AA Change: Y308H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077344
Gene: ENSMUSG00000096806
AA Change: Y308H

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.5e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1.9e-8 PFAM
Pfam:7tm_1 39 288 4.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216407
AA Change: Y308H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Olfr312
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Olfr312 APN 11 58831639 missense probably damaging 1.00
R0442:Olfr312 UTSW 11 58831431 nonsense probably null
R0540:Olfr312 UTSW 11 58831972 missense probably damaging 0.96
R0607:Olfr312 UTSW 11 58831972 missense probably damaging 0.96
R2366:Olfr312 UTSW 11 58831213 missense probably benign 0.00
R3437:Olfr312 UTSW 11 58831324 missense probably damaging 1.00
R4135:Olfr312 UTSW 11 58831994 missense probably damaging 1.00
R4391:Olfr312 UTSW 11 58832015 missense possibly damaging 0.81
R5557:Olfr312 UTSW 11 58831987 missense probably benign 0.01
R5564:Olfr312 UTSW 11 58831213 nonsense probably null
R5854:Olfr312 UTSW 11 58831556 missense probably damaging 0.99
R7336:Olfr312 UTSW 11 58831924 missense probably damaging 0.99
R7344:Olfr312 UTSW 11 58831482 missense probably damaging 1.00
R7397:Olfr312 UTSW 11 58831289 missense probably benign 0.05
X0067:Olfr312 UTSW 11 58831988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTGGAAGCTTTGTGTATC -3'
(R):5'- TCCAGCAAACAGTTTTGTCAGC -3'

Sequencing Primer
(F):5'- AAGCTTTGTGTATCTGAGGCCC -3'
(R):5'- CACATAGTTCTGGGTGCCCATG -3'
Posted On2018-08-29