Incidental Mutation 'R6791:Neurl4'
ID532603
Institutional Source Beutler Lab
Gene Symbol Neurl4
Ensembl Gene ENSMUSG00000047284
Gene Nameneuralized E3 ubiquitin protein ligase 4
Synonyms0610025P10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6791 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69901072-69913820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69908510 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 904 (L904Q)
Ref Sequence ENSEMBL: ENSMUSP00000135277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061837] [ENSMUST00000108617] [ENSMUST00000129475] [ENSMUST00000133203] [ENSMUST00000177138] [ENSMUST00000177476]
Predicted Effect probably damaging
Transcript: ENSMUST00000061837
AA Change: L928Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284
AA Change: L928Q

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108617
AA Change: L906Q

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284
AA Change: L906Q

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129475
SMART Domains Protein: ENSMUSP00000135733
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 1 119 4.22e-44 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
internal_repeat_1 206 246 1.46e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000132183
SMART Domains Protein: ENSMUSP00000118868
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 161 172 N/A INTRINSIC
low complexity region 182 191 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133203
AA Change: L671Q

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284
AA Change: L671Q

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177138
AA Change: L904Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284
AA Change: L904Q

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177476
AA Change: L926Q

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284
AA Change: L926Q

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Meta Mutation Damage Score 0.6966 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted and it includes two isoforms resulting from two alternatively spliced transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Neurl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Neurl4 APN 11 69904587 missense probably damaging 1.00
IGL00516:Neurl4 APN 11 69910393 missense probably damaging 0.98
IGL01409:Neurl4 APN 11 69907099 missense probably damaging 1.00
IGL01951:Neurl4 APN 11 69909623 missense probably damaging 1.00
IGL02056:Neurl4 APN 11 69905790 missense probably damaging 1.00
IGL02206:Neurl4 APN 11 69910340 missense probably damaging 1.00
IGL02557:Neurl4 APN 11 69906335 missense probably damaging 1.00
IGL02878:Neurl4 APN 11 69906831 missense probably damaging 1.00
P0022:Neurl4 UTSW 11 69909065 missense possibly damaging 0.86
PIT4377001:Neurl4 UTSW 11 69910406 missense probably benign 0.41
R0388:Neurl4 UTSW 11 69911733 splice site probably benign
R0421:Neurl4 UTSW 11 69908534 missense probably damaging 1.00
R0449:Neurl4 UTSW 11 69905567 missense probably damaging 0.99
R1174:Neurl4 UTSW 11 69903721 critical splice donor site probably null
R1345:Neurl4 UTSW 11 69903876 missense probably benign 0.21
R1536:Neurl4 UTSW 11 69903426 nonsense probably null
R1642:Neurl4 UTSW 11 69903659 missense probably benign 0.03
R1857:Neurl4 UTSW 11 69905535 missense probably damaging 1.00
R1935:Neurl4 UTSW 11 69907133 missense probably damaging 1.00
R1936:Neurl4 UTSW 11 69907133 missense probably damaging 1.00
R1967:Neurl4 UTSW 11 69903210 missense possibly damaging 0.90
R1973:Neurl4 UTSW 11 69909292 missense probably benign
R2046:Neurl4 UTSW 11 69908697 missense probably damaging 1.00
R2165:Neurl4 UTSW 11 69903221 missense probably benign
R2393:Neurl4 UTSW 11 69907074 missense probably damaging 1.00
R3810:Neurl4 UTSW 11 69904033 missense probably damaging 1.00
R4299:Neurl4 UTSW 11 69909061 missense probably damaging 1.00
R4749:Neurl4 UTSW 11 69911068 missense probably benign 0.00
R4898:Neurl4 UTSW 11 69903171 missense probably damaging 0.99
R4968:Neurl4 UTSW 11 69907308 missense probably damaging 1.00
R4969:Neurl4 UTSW 11 69911087 missense probably damaging 1.00
R5503:Neurl4 UTSW 11 69906368 missense probably damaging 1.00
R6655:Neurl4 UTSW 11 69910916 critical splice donor site probably null
R7029:Neurl4 UTSW 11 69910736 missense probably damaging 0.99
R7216:Neurl4 UTSW 11 69910262 missense probably damaging 1.00
R7361:Neurl4 UTSW 11 69912079 missense probably benign 0.01
R7367:Neurl4 UTSW 11 69908582 missense probably damaging 1.00
R7804:Neurl4 UTSW 11 69905874 missense probably benign 0.00
R7871:Neurl4 UTSW 11 69903186 missense probably benign
R8092:Neurl4 UTSW 11 69911065 missense probably benign
R8121:Neurl4 UTSW 11 69908230 splice site probably null
R8131:Neurl4 UTSW 11 69909241 missense probably benign 0.12
R8289:Neurl4 UTSW 11 69909380 critical splice donor site probably null
R8354:Neurl4 UTSW 11 69909236 missense probably damaging 0.97
R8494:Neurl4 UTSW 11 69911045 missense probably benign 0.02
R8529:Neurl4 UTSW 11 69908787 missense probably damaging 1.00
X0025:Neurl4 UTSW 11 69906801 missense probably damaging 1.00
Z1177:Neurl4 UTSW 11 69904090 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ACTGGGCATCTTGAGTCTTACTG -3'
(R):5'- CATGTCCTCTGGTGCAAGTG -3'

Sequencing Primer
(F):5'- CATCTTGAGTCTTACTGTGGTGCAAG -3'
(R):5'- TGCAAGTGTGGTCAGCC -3'
Posted On2018-08-29