Incidental Mutation 'R6791:Fbxl20'
ID532606
Institutional Source Beutler Lab
Gene Symbol Fbxl20
Ensembl Gene ENSMUSG00000020883
Gene NameF-box and leucine-rich repeat protein 20
Synonyms2610511F20Rik, C86145, 4632423N09Rik, Fbl2, Scrapper, Scr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R6791 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location98082556-98150403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98109510 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 128 (T128A)
Ref Sequence ENSEMBL: ENSMUSP00000099432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103143] [ENSMUST00000149327] [ENSMUST00000150378]
Predicted Effect probably benign
Transcript: ENSMUST00000103143
AA Change: T128A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099432
Gene: ENSMUSG00000020883
AA Change: T128A

DomainStartEndE-ValueType
FBOX 28 68 2.62e-8 SMART
LRR 90 115 2.02e-1 SMART
LRR 116 141 1.77e1 SMART
LRR 142 167 7.9e-4 SMART
LRR_CC 168 193 4.61e-5 SMART
LRR 194 219 7.15e-2 SMART
LRR 220 245 1.67e-2 SMART
LRR 246 271 1.2e-3 SMART
LRR 272 297 2.61e-4 SMART
LRR 298 323 1.26e-2 SMART
LRR_CC 324 349 1.77e-6 SMART
LRR 353 377 6.06e2 SMART
LRR 378 403 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149327
SMART Domains Protein: ENSMUSP00000120709
Gene: ENSMUSG00000020883

DomainStartEndE-ValueType
FBOX 14 54 2.62e-8 SMART
Blast:LRR 76 101 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150378
SMART Domains Protein: ENSMUSP00000119003
Gene: ENSMUSG00000020883

DomainStartEndE-ValueType
FBOX 30 70 2.62e-8 SMART
LRR 92 117 3.69e1 SMART
LRR 121 146 7.9e-4 SMART
LRR_CC 147 172 4.61e-5 SMART
LRR 173 198 7.15e-2 SMART
Meta Mutation Damage Score 0.1536 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL20, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, shortened lifespans, decreased body size and altered CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Fbxl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Fbxl20 APN 11 98090674 missense possibly damaging 0.70
IGL00161:Fbxl20 APN 11 98090674 missense possibly damaging 0.70
IGL00590:Fbxl20 APN 11 98093129 missense probably damaging 1.00
IGL00944:Fbxl20 APN 11 98113242 missense probably damaging 1.00
IGL00966:Fbxl20 APN 11 98110974 missense probably damaging 1.00
IGL01344:Fbxl20 APN 11 98100100 nonsense probably null
IGL02394:Fbxl20 APN 11 98113256 missense probably damaging 1.00
R0270:Fbxl20 UTSW 11 98098503 splice site probably benign
R1564:Fbxl20 UTSW 11 98098486 missense probably damaging 1.00
R2227:Fbxl20 UTSW 11 98090849 missense probably benign 0.12
R3902:Fbxl20 UTSW 11 98097035 missense probably benign 0.03
R4158:Fbxl20 UTSW 11 98095394 unclassified probably benign
R4516:Fbxl20 UTSW 11 98095235 unclassified probably benign
R4916:Fbxl20 UTSW 11 98128360 missense probably damaging 1.00
R5905:Fbxl20 UTSW 11 98115445 missense probably damaging 1.00
R6916:Fbxl20 UTSW 11 98113253 missense possibly damaging 0.78
R7381:Fbxl20 UTSW 11 98090788 missense probably benign 0.01
R7536:Fbxl20 UTSW 11 98095383 nonsense probably null
X0067:Fbxl20 UTSW 11 98096978 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AGGAAGCCTTCTGTTCCACCTC -3'
(R):5'- GCAGATAGGTACTGGCTATTTCC -3'

Sequencing Primer
(F):5'- CTTCTAGCACTGGGGACGTAG -3'
(R):5'- ACTTGCTAGCATGAGTCCAG -3'
Posted On2018-08-29