Incidental Mutation 'R6791:Tbc1d4'
ID532612
Institutional Source Beutler Lab
Gene Symbol Tbc1d4
Ensembl Gene ENSMUSG00000033083
Gene NameTBC1 domain family, member 4
Synonyms5930406J04Rik, AS160
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6791 (G1)
Quality Score114.008
Status Validated
Chromosome14
Chromosomal Location101442360-101609191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101608259 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 68 (K68Q)
Ref Sequence ENSEMBL: ENSMUSP00000124909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100340] [ENSMUST00000161991] [ENSMUST00000162617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100340
AA Change: K68Q

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097913
Gene: ENSMUSG00000033083
AA Change: K68Q

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Blast:TBC 773 834 3e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000161991
AA Change: K68Q

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125509
Gene: ENSMUSG00000033083
AA Change: K68Q

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
Pfam:DUF3350 746 809 1.2e-27 PFAM
TBC 860 1080 5.2e-77 SMART
Blast:TBC 1105 1163 1e-23 BLAST
Blast:TBC 1168 1222 1e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162617
AA Change: K68Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124909
Gene: ENSMUSG00000033083
AA Change: K68Q

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Pfam:DUF3350 809 872 3.3e-31 PFAM
TBC 923 1143 5.2e-77 SMART
Blast:TBC 1168 1226 2e-23 BLAST
Blast:TBC 1231 1285 1e-20 BLAST
Meta Mutation Damage Score 0.0805 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tre-2/BUB2/CDC16 domain family. The protein encoded by this gene is a Rab-GTPase-activating protein, and contains two phopshotyrosine-binding domains (PTB1 and PTB2), a calmodulin-binding domain (CBD), a Rab-GTPase domain, and multiple AKT phosphomotifs. This protein is thought to play an important role in glucose homeostasis by regulating the insulin-dependent trafficking of the glucose transporter 4 (GLUT4), important for removing glucose from the bloodstream into skeletal muscle and fat tissues. Reduced expression of this gene results in an increase in GLUT4 levels at the plasma membrane, suggesting that this protein is important in intracellular retention of GLUT4 under basal conditions. When exposed to insulin, this protein is phosphorylated, dissociates from GLUT4 vesicles, resulting in increased GLUT4 at the cell surface, and enhanced glucose transport. Phosphorylation of this protein by AKT is required for proper translocation of GLUT4 to the cell surface. Individuals homozygous for a mutation in this gene are at higher risk for type 2 diabetes and have higher levels of circulating glucose and insulin levels after glucose ingestion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced blood glucose levels under both fasted and fed conditions, insulin resistance in both muscle and liver, decreased energy expenditure and oxygen consumption, abnormal adipocyte and muscle cell glucose uptake, and increased hepatic gluconeogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Tbc1d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tbc1d4 APN 14 101608112 missense probably damaging 1.00
IGL00864:Tbc1d4 APN 14 101444566 missense probably benign 0.23
IGL01065:Tbc1d4 APN 14 101449193 splice site probably benign
IGL01144:Tbc1d4 APN 14 101444663 missense probably damaging 0.99
IGL01153:Tbc1d4 APN 14 101608015 missense possibly damaging 0.52
IGL01472:Tbc1d4 APN 14 101489864 nonsense probably null
IGL02177:Tbc1d4 APN 14 101454939 missense possibly damaging 0.90
IGL02259:Tbc1d4 APN 14 101465730 missense probably damaging 1.00
IGL02938:Tbc1d4 APN 14 101501100 missense probably damaging 1.00
IGL02975:Tbc1d4 APN 14 101458113 missense probably damaging 1.00
R0396:Tbc1d4 UTSW 14 101458063 splice site probably null
R0787:Tbc1d4 UTSW 14 101449209 missense probably damaging 1.00
R0944:Tbc1d4 UTSW 14 101479220 splice site probably benign
R1167:Tbc1d4 UTSW 14 101608019 missense probably damaging 1.00
R1456:Tbc1d4 UTSW 14 101507106 missense probably damaging 1.00
R1465:Tbc1d4 UTSW 14 101447688 missense possibly damaging 0.87
R1465:Tbc1d4 UTSW 14 101447688 missense possibly damaging 0.87
R1672:Tbc1d4 UTSW 14 101475215 missense possibly damaging 0.92
R1762:Tbc1d4 UTSW 14 101507138 missense possibly damaging 0.95
R2057:Tbc1d4 UTSW 14 101477155 missense probably damaging 0.97
R2260:Tbc1d4 UTSW 14 101494411 missense probably damaging 1.00
R2762:Tbc1d4 UTSW 14 101494361 missense probably damaging 1.00
R3814:Tbc1d4 UTSW 14 101458755 missense possibly damaging 0.94
R3983:Tbc1d4 UTSW 14 101507213 missense probably benign 0.00
R4498:Tbc1d4 UTSW 14 101608336 missense probably damaging 1.00
R4580:Tbc1d4 UTSW 14 101458783 missense probably benign 0.00
R4664:Tbc1d4 UTSW 14 101462827 intron probably benign
R4872:Tbc1d4 UTSW 14 101444708 missense probably benign 0.06
R4940:Tbc1d4 UTSW 14 101507231 missense probably benign 0.27
R4964:Tbc1d4 UTSW 14 101458174 missense probably damaging 1.00
R4966:Tbc1d4 UTSW 14 101458174 missense probably damaging 1.00
R5103:Tbc1d4 UTSW 14 101458882 nonsense probably null
R5180:Tbc1d4 UTSW 14 101507572 missense probably damaging 1.00
R5366:Tbc1d4 UTSW 14 101607976 missense possibly damaging 0.67
R5673:Tbc1d4 UTSW 14 101455008 missense probably damaging 1.00
R6057:Tbc1d4 UTSW 14 101489917 missense probably damaging 0.99
R6180:Tbc1d4 UTSW 14 101458770 missense probably benign 0.01
R6361:Tbc1d4 UTSW 14 101507174 missense probably damaging 0.97
R6509:Tbc1d4 UTSW 14 101608318 missense possibly damaging 0.92
R7001:Tbc1d4 UTSW 14 101458749 missense probably benign 0.43
R7016:Tbc1d4 UTSW 14 101487441 missense probably damaging 1.00
R7575:Tbc1d4 UTSW 14 101447589 missense probably damaging 1.00
R7691:Tbc1d4 UTSW 14 101507641 missense probably damaging 1.00
R7936:Tbc1d4 UTSW 14 101465754 missense probably damaging 1.00
R7991:Tbc1d4 UTSW 14 101608279 missense probably damaging 0.98
R8182:Tbc1d4 UTSW 14 101507554 missense probably damaging 1.00
R8540:Tbc1d4 UTSW 14 101608276 missense probably damaging 1.00
Z1088:Tbc1d4 UTSW 14 101452423 missense probably damaging 1.00
Z1176:Tbc1d4 UTSW 14 101507087 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGTTGTGGATGAAGCGC -3'
(R):5'- GAGTTATGGAGTCGCCTAGC -3'

Sequencing Primer
(F):5'- CGAGATGTGCTGAGCCTTG -3'
(R):5'- TAGCTGCATTCAGGATGAGCC -3'
Posted On2018-08-29