Incidental Mutation 'R6791:Treml2'
ID532614
Institutional Source Beutler Lab
Gene Symbol Treml2
Ensembl Gene ENSMUSG00000071068
Gene Nametriggering receptor expressed on myeloid cells-like 2
SynonymsLOC328833
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6791 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location48300038-48312534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48309219 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 296 (M296V)
Ref Sequence ENSEMBL: ENSMUSP00000128215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170941]
Predicted Effect probably benign
Transcript: ENSMUST00000170941
AA Change: M296V

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128215
Gene: ENSMUSG00000071068
AA Change: M296V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 129 3.13e-5 SMART
low complexity region 181 199 N/A INTRINSIC
transmembrane domain 268 290 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TREML2 is located in a gene cluster on chromosome 6 with the single Ig variable (IgV) domain activating receptors TREM1 (MIM 605085) and TREM2 (MIM 605086), but it has distinct structural and functional properties (Allcock et al., 2003 [PubMed 12645956]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Treml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Treml2 APN 17 48302810 missense probably benign
IGL02797:Treml2 APN 17 48302711 missense possibly damaging 0.73
poplar UTSW 17 48302734 nonsense probably null
R0105:Treml2 UTSW 17 48302828 missense probably damaging 0.99
R0105:Treml2 UTSW 17 48302828 missense probably damaging 0.99
R0670:Treml2 UTSW 17 48307836 splice site probably null
R1538:Treml2 UTSW 17 48302758 missense possibly damaging 0.77
R1796:Treml2 UTSW 17 48309502 makesense probably null
R4396:Treml2 UTSW 17 48308114 missense probably benign 0.00
R4679:Treml2 UTSW 17 48308175 missense probably benign 0.36
R4687:Treml2 UTSW 17 48309397 splice site probably null
R4801:Treml2 UTSW 17 48309159 missense probably benign 0.18
R4802:Treml2 UTSW 17 48309159 missense probably benign 0.18
R5314:Treml2 UTSW 17 48300573 missense probably damaging 0.99
R6818:Treml2 UTSW 17 48302897 missense probably damaging 1.00
R6958:Treml2 UTSW 17 48308152 missense probably damaging 1.00
R7250:Treml2 UTSW 17 48309127 missense probably benign 0.05
R7535:Treml2 UTSW 17 48302819 missense probably damaging 1.00
R7850:Treml2 UTSW 17 48308140 missense probably benign 0.01
R8049:Treml2 UTSW 17 48302734 nonsense probably null
R9012:Treml2 UTSW 17 48308062 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCTGCCAAAGAAAGCTGTGAC -3'
(R):5'- AGGTGTATCCAGGGTTTAGCATAG -3'

Sequencing Primer
(F):5'- CTGTGACCACGGTGGAGAATC -3'
(R):5'- CATAGTTGCTGCCCAAGTTG -3'
Posted On2018-08-29