Incidental Mutation 'R6791:Gm8369'
ID532617
Institutional Source Beutler Lab
Gene Symbol Gm8369
Ensembl Gene ENSMUSG00000058470
Gene Namepredicted gene 8369
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6791 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11485938-11512577 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 11511836 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079855] [ENSMUST00000163078] [ENSMUST00000186423] [ENSMUST00000188633]
Predicted Effect unknown
Transcript: ENSMUST00000079855
AA Change: N162K
SMART Domains Protein: ENSMUSP00000132521
Gene: ENSMUSG00000058470
AA Change: N162K

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163078
SMART Domains Protein: ENSMUSP00000124685
Gene: ENSMUSG00000024677

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186423
SMART Domains Protein: ENSMUSP00000140897
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 1 62 5.7e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000188633
AA Change: N162K
SMART Domains Protein: ENSMUSP00000141067
Gene: ENSMUSG00000058470
AA Change: N162K

DomainStartEndE-ValueType
Pfam:CD20 2 48 3.7e-9 PFAM
low complexity region 130 145 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Gm8369
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1013:Gm8369 UTSW 19 11511783 frame shift probably null
R4192:Gm8369 UTSW 19 11502232 missense probably damaging 0.97
R5445:Gm8369 UTSW 19 11504806 missense possibly damaging 0.55
R5809:Gm8369 UTSW 19 11504884 intron probably benign
R6258:Gm8369 UTSW 19 11511609 missense possibly damaging 0.93
RF004:Gm8369 UTSW 19 11511754 small insertion probably benign
RF006:Gm8369 UTSW 19 11511764 small insertion probably benign
RF008:Gm8369 UTSW 19 11511754 frame shift probably null
RF016:Gm8369 UTSW 19 11511754 frame shift probably null
RF017:Gm8369 UTSW 19 11511742 frame shift probably null
RF018:Gm8369 UTSW 19 11511742 frame shift probably null
RF025:Gm8369 UTSW 19 11511773 frame shift probably null
RF028:Gm8369 UTSW 19 11511773 nonsense probably null
RF032:Gm8369 UTSW 19 11511778 small insertion probably benign
RF033:Gm8369 UTSW 19 11511778 small insertion probably benign
RF035:Gm8369 UTSW 19 11511773 small insertion probably benign
RF036:Gm8369 UTSW 19 11511778 small insertion probably benign
RF037:Gm8369 UTSW 19 11511782 small insertion probably benign
RF039:Gm8369 UTSW 19 11511758 small insertion probably benign
RF039:Gm8369 UTSW 19 11511782 small insertion probably benign
RF041:Gm8369 UTSW 19 11511758 small insertion probably benign
RF042:Gm8369 UTSW 19 11511773 frame shift probably null
RF042:Gm8369 UTSW 19 11511778 small insertion probably benign
RF054:Gm8369 UTSW 19 11511764 frame shift probably null
RF055:Gm8369 UTSW 19 11511748 frame shift probably null
Z1176:Gm8369 UTSW 19 11511624 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACAGTGATGGCATCTCCC -3'
(R):5'- TGTGTCTGCTCCTGATCATG -3'

Sequencing Primer
(F):5'- CTTCAACCATTGCTACCATCAG -3'
(R):5'- GCTCCTGATCATGAGCAACTAAATC -3'
Posted On2018-08-29