Incidental Mutation 'R6791:Pax2'
ID532618
Institutional Source Beutler Lab
Gene Symbol Pax2
Ensembl Gene ENSMUSG00000004231
Gene Namepaired box 2
SynonymsPax-2, Opdc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6791 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location44756045-44837871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44788821 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 151 (D151V)
Ref Sequence ENSEMBL: ENSMUSP00000004340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004340] [ENSMUST00000173346] [ENSMUST00000174490]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004340
AA Change: D151V

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000004340
Gene: ENSMUSG00000004231
AA Change: D151V

DomainStartEndE-ValueType
PAX 15 139 4e-96 SMART
low complexity region 165 177 N/A INTRINSIC
SCOP:d1ftt__ 246 280 1e-4 SMART
Pfam:Pax2_C 300 415 1.1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173346
AA Change: D156V

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134311
Gene: ENSMUSG00000004231
AA Change: D156V

DomainStartEndE-ValueType
PAX 20 144 2.3e-96 SMART
low complexity region 170 182 N/A INTRINSIC
SCOP:d1ftt__ 220 254 5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174490
AA Change: D152V

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134661
Gene: ENSMUSG00000004231
AA Change: D152V

DomainStartEndE-ValueType
PAX 16 140 2.3e-96 SMART
low complexity region 166 178 N/A INTRINSIC
SCOP:d1ftt__ 224 258 8e-5 SMART
Pfam:Pax2_C 278 393 6.3e-57 PFAM
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous targeted and spontaneous null mutants show impaired to absent development of optic nerve, retina, kidney, ureters, genital tracts, inner ear and midhindbrain. Heterozygotes show milder defects of the optic nerve, retina and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Pax2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Pax2 APN 19 44790688 missense probably damaging 0.99
IGL02368:Pax2 APN 19 44835409 missense possibly damaging 0.55
IGL03146:Pax2 APN 19 44833275 splice site probably benign
R0084:Pax2 UTSW 19 44818435 missense probably damaging 1.00
R0554:Pax2 UTSW 19 44761861 missense probably damaging 1.00
R1116:Pax2 UTSW 19 44757424 missense probably damaging 0.99
R1951:Pax2 UTSW 19 44788832 missense probably benign 0.09
R1952:Pax2 UTSW 19 44788832 missense probably benign 0.09
R1981:Pax2 UTSW 19 44818465 missense probably damaging 1.00
R3015:Pax2 UTSW 19 44816024 missense probably damaging 1.00
R4320:Pax2 UTSW 19 44835399 missense probably damaging 0.97
R4561:Pax2 UTSW 19 44835963 missense unknown
R4562:Pax2 UTSW 19 44835963 missense unknown
R4661:Pax2 UTSW 19 44760937 missense probably damaging 1.00
R4948:Pax2 UTSW 19 44816040 missense probably damaging 1.00
R5131:Pax2 UTSW 19 44760955 missense probably damaging 0.98
R5622:Pax2 UTSW 19 44818466 missense probably damaging 1.00
R5661:Pax2 UTSW 19 44790722 missense probably damaging 1.00
R6110:Pax2 UTSW 19 44790736 missense probably damaging 0.99
R6171:Pax2 UTSW 19 44790740 missense probably damaging 1.00
R6713:Pax2 UTSW 19 44835477 missense unknown
R7156:Pax2 UTSW 19 44788859 missense probably benign 0.00
R7679:Pax2 UTSW 19 44760937 missense probably damaging 1.00
R7695:Pax2 UTSW 19 44833199 missense probably damaging 1.00
R8005:Pax2 UTSW 19 44760889 missense probably damaging 1.00
R8555:Pax2 UTSW 19 44761689 missense probably damaging 1.00
R8849:Pax2 UTSW 19 44760672 intron probably benign
R8878:Pax2 UTSW 19 44788776 critical splice acceptor site probably null
X0018:Pax2 UTSW 19 44796676 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCTAAGTGGATTGCAGAGCAG -3'
(R):5'- GGGAGGCACTGAACTAATACC -3'

Sequencing Primer
(F):5'- TGGATTGCAGAGCAGACAGG -3'
(R):5'- GGAGGCACTGAACTAATACCACCAG -3'
Posted On2018-08-29