Incidental Mutation 'R6792:Traf1'
ID532622
Institutional Source Beutler Lab
Gene Symbol Traf1
Ensembl Gene ENSMUSG00000026875
Gene NameTNF receptor-associated factor 1
Synonyms4732496E14Rik
MMRRC Submission
Accession Numbers

Genbank: NM_009421; MGI: 101836

Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6792 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location34941750-34961772 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34956275 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 43 (D43G)
Ref Sequence ENSEMBL: ENSMUSP00000144189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028234] [ENSMUST00000113064] [ENSMUST00000172159] [ENSMUST00000201690]
Predicted Effect probably benign
Transcript: ENSMUST00000028234
AA Change: D43G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028234
Gene: ENSMUSG00000026875
AA Change: D43G

DomainStartEndE-ValueType
Pfam:TRAF_BIRC3_bd 175 238 8.4e-19 PFAM
MATH 264 386 8.29e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113064
AA Change: D43G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108687
Gene: ENSMUSG00000026875
AA Change: D43G

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
MATH 264 386 8.29e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172159
AA Change: D43G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130759
Gene: ENSMUSG00000026875
AA Change: D43G

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
MATH 264 386 8.29e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201690
AA Change: D43G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor (TNFR) associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from various receptors of the TNFR superfamily. This protein and TRAF2 form a heterodimeric complex, which is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF2 also interacts with inhibitor-of-apoptosis proteins (IAPs), and thus mediates the anti-apoptotic signals from TNF receptors. The expression of this protein can be induced by Epstein-Barr virus (EBV). EBV infection membrane protein 1 (LMP1) is found to interact with this and other TRAF proteins; this interaction is thought to link LMP1-mediated B lymphocyte transformation to the signal transduction from TNFR family receptors. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice exhibit abnormal T cell functionality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,115 E316G possibly damaging Het
4932438A13Rik A G 3: 37,011,566 probably null Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Akap2 A G 4: 57,855,880 D403G possibly damaging Het
Aldh2 C T 5: 121,580,649 G64R probably damaging Het
Atp11a G A 8: 12,861,939 probably benign Het
Bcl11b T C 12: 107,989,734 D52G probably damaging Het
Capg T A 6: 72,555,554 I34K possibly damaging Het
Card11 T A 5: 140,913,309 I37F probably damaging Het
Col27a1 G T 4: 63,317,503 R724L unknown Het
Cryl1 T C 14: 57,382,767 E47G probably damaging Het
Dgkb A T 12: 38,100,425 D70V possibly damaging Het
Dscam T C 16: 96,593,255 E1949G probably damaging Het
Dscam A G 16: 96,648,237 V1387A probably damaging Het
Exph5 G A 9: 53,375,317 V1233M possibly damaging Het
Fat3 A T 9: 16,375,644 V861E probably damaging Het
Fgfr4 T G 13: 55,156,898 D184E possibly damaging Het
Fkbp14 G T 6: 54,585,852 S49* probably null Het
Ginm1 T C 10: 7,773,983 D182G probably damaging Het
Gk2 T C 5: 97,455,729 I417V probably benign Het
Gm21677 A G Y: 3,298,867 Y206H possibly damaging Homo
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Malrd1 C T 2: 16,150,756 P1992L unknown Het
Mapk6 A T 9: 75,395,548 I221N probably damaging Het
Mup9 A G 4: 60,421,355 V65A possibly damaging Het
Myo15b A G 11: 115,885,097 D805G probably damaging Het
Olfr1082 A T 2: 86,593,939 D296E probably benign Het
Olfr69 A G 7: 103,768,139 I86T possibly damaging Het
Otof T A 5: 30,375,634 H1588L probably damaging Het
Pde4a A G 9: 21,192,590 K145R probably benign Het
Pik3ap1 A T 19: 41,321,626 D418E probably benign Het
Pilrb2 C A 5: 137,868,590 R217M possibly damaging Het
Plcb2 T C 2: 118,719,441 N232S probably damaging Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Ppp2r5d A G 17: 46,704,856 S2P probably benign Het
Prr5l T G 2: 101,717,424 N252T probably benign Het
Rilp A T 11: 75,512,775 K348* probably null Het
Slc17a7 A G 7: 45,174,875 E505G possibly damaging Het
Slc6a21 T A 7: 45,279,885 M1K probably null Het
Sorcs1 T C 19: 50,678,168 T101A probably benign Het
Sorl1 A T 9: 42,099,263 V137E probably damaging Het
Stam2 T C 2: 52,707,981 I270V probably benign Het
Synj2 G A 17: 5,990,290 A214T probably benign Het
Tarsl2 G T 7: 65,662,303 C321F probably damaging Het
Tcea1 T A 1: 4,892,045 D229E probably benign Het
Tdrd9 C T 12: 112,027,113 R692W probably benign Het
Tkfc T C 19: 10,594,524 T383A probably benign Het
Tubgcp6 C T 15: 89,122,877 probably benign Het
Vit A T 17: 78,579,399 Y152F probably damaging Het
Vmn1r66 A T 7: 10,274,485 M207K possibly damaging Het
Other mutations in Traf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Traf1 APN 2 34943893 missense probably benign 0.00
IGL01993:Traf1 APN 2 34946867 splice site probably benign
IGL02429:Traf1 APN 2 34949103 missense probably benign
IGL02752:Traf1 APN 2 34958008 missense probably benign 0.00
IGL02933:Traf1 APN 2 34949095 missense possibly damaging 0.55
IGL03346:Traf1 APN 2 34948472 missense probably benign 0.01
3-1:Traf1 UTSW 2 34949106 critical splice acceptor site probably null
R0220:Traf1 UTSW 2 34949103 missense probably benign
R2064:Traf1 UTSW 2 34948190 missense probably benign 0.07
R4458:Traf1 UTSW 2 34945433 missense probably damaging 1.00
R4797:Traf1 UTSW 2 34956277 missense probably benign 0.17
R5398:Traf1 UTSW 2 34945435 missense probably damaging 1.00
R6221:Traf1 UTSW 2 34948301 missense probably benign 0.45
R6584:Traf1 UTSW 2 34958058 missense probably damaging 1.00
R7350:Traf1 UTSW 2 34948233 missense probably benign 0.11
R8331:Traf1 UTSW 2 34948358 missense probably damaging 1.00
Z1177:Traf1 UTSW 2 34945435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAAACTCATTGTGGGTTC -3'
(R):5'- CACCCATGGTTTCGAAGACC -3'

Sequencing Primer
(F):5'- TATGAGACCAGGTCCTGATTAGCC -3'
(R):5'- CCATGGTTTCGAAGACCTTAGCAG -3'
Posted On2018-08-29