Incidental Mutation 'R6792:Prr5l'
ID532625
Institutional Source Beutler Lab
Gene Symbol Prr5l
Ensembl Gene ENSMUSG00000032841
Gene Nameproline rich 5 like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6792 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location101714285-101883027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101717424 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 252 (N252T)
Ref Sequence ENSEMBL: ENSMUSP00000130152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043845] [ENSMUST00000163762] [ENSMUST00000171088]
Predicted Effect probably benign
Transcript: ENSMUST00000043845
AA Change: N252T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000042167
Gene: ENSMUSG00000032841
AA Change: N252T

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 47 152 5.4e-15 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141814
AA Change: N180T
SMART Domains Protein: ENSMUSP00000118537
Gene: ENSMUSG00000032841
AA Change: N180T

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163762
AA Change: N252T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127530
Gene: ENSMUSG00000032841
AA Change: N252T

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 177 2.8e-36 PFAM
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171088
AA Change: N252T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130152
Gene: ENSMUSG00000032841
AA Change: N252T

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 177 2.8e-36 PFAM
low complexity region 323 332 N/A INTRINSIC
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,115 E316G possibly damaging Het
4932438A13Rik A G 3: 37,011,566 probably null Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Akap2 A G 4: 57,855,880 D403G possibly damaging Het
Aldh2 C T 5: 121,580,649 G64R probably damaging Het
Atp11a G A 8: 12,861,939 probably benign Het
Bcl11b T C 12: 107,989,734 D52G probably damaging Het
Capg T A 6: 72,555,554 I34K possibly damaging Het
Card11 T A 5: 140,913,309 I37F probably damaging Het
Col27a1 G T 4: 63,317,503 R724L unknown Het
Cryl1 T C 14: 57,382,767 E47G probably damaging Het
Dgkb A T 12: 38,100,425 D70V possibly damaging Het
Dscam T C 16: 96,593,255 E1949G probably damaging Het
Dscam A G 16: 96,648,237 V1387A probably damaging Het
Exph5 G A 9: 53,375,317 V1233M possibly damaging Het
Fat3 A T 9: 16,375,644 V861E probably damaging Het
Fgfr4 T G 13: 55,156,898 D184E possibly damaging Het
Fkbp14 G T 6: 54,585,852 S49* probably null Het
Ginm1 T C 10: 7,773,983 D182G probably damaging Het
Gk2 T C 5: 97,455,729 I417V probably benign Het
Gm21677 A G Y: 3,298,867 Y206H possibly damaging Homo
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Malrd1 C T 2: 16,150,756 P1992L unknown Het
Mapk6 A T 9: 75,395,548 I221N probably damaging Het
Mup9 A G 4: 60,421,355 V65A possibly damaging Het
Myo15b A G 11: 115,885,097 D805G probably damaging Het
Olfr1082 A T 2: 86,593,939 D296E probably benign Het
Olfr69 A G 7: 103,768,139 I86T possibly damaging Het
Otof T A 5: 30,375,634 H1588L probably damaging Het
Pde4a A G 9: 21,192,590 K145R probably benign Het
Pik3ap1 A T 19: 41,321,626 D418E probably benign Het
Pilrb2 C A 5: 137,868,590 R217M possibly damaging Het
Plcb2 T C 2: 118,719,441 N232S probably damaging Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Ppp2r5d A G 17: 46,704,856 S2P probably benign Het
Rilp A T 11: 75,512,775 K348* probably null Het
Slc17a7 A G 7: 45,174,875 E505G possibly damaging Het
Slc6a21 T A 7: 45,279,885 M1K probably null Het
Sorcs1 T C 19: 50,678,168 T101A probably benign Het
Sorl1 A T 9: 42,099,263 V137E probably damaging Het
Stam2 T C 2: 52,707,981 I270V probably benign Het
Synj2 G A 17: 5,990,290 A214T probably benign Het
Tarsl2 G T 7: 65,662,303 C321F probably damaging Het
Tcea1 T A 1: 4,892,045 D229E probably benign Het
Tdrd9 C T 12: 112,027,113 R692W probably benign Het
Tkfc T C 19: 10,594,524 T383A probably benign Het
Traf1 T C 2: 34,956,275 D43G probably benign Het
Tubgcp6 C T 15: 89,122,877 probably benign Het
Vit A T 17: 78,579,399 Y152F probably damaging Het
Vmn1r66 A T 7: 10,274,485 M207K possibly damaging Het
Other mutations in Prr5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Prr5l APN 2 101772120 splice site probably benign
IGL02946:Prr5l APN 2 101772184 splice site probably null
PIT4618001:Prr5l UTSW 2 101758530 missense probably damaging 0.99
R0652:Prr5l UTSW 2 101772290 missense possibly damaging 0.94
R0722:Prr5l UTSW 2 101717474 splice site probably benign
R0882:Prr5l UTSW 2 101758541 missense possibly damaging 0.81
R1962:Prr5l UTSW 2 101758509 critical splice donor site probably null
R3013:Prr5l UTSW 2 101734705 missense probably damaging 1.00
R4564:Prr5l UTSW 2 101746749 missense probably damaging 1.00
R4604:Prr5l UTSW 2 101729448 missense probably benign 0.44
R4902:Prr5l UTSW 2 101797682 utr 5 prime probably benign
R5338:Prr5l UTSW 2 101717107 missense probably benign 0.00
R6279:Prr5l UTSW 2 101717420 nonsense probably null
R7214:Prr5l UTSW 2 101729432 missense probably benign
R7299:Prr5l UTSW 2 101717286 missense probably damaging 1.00
R7301:Prr5l UTSW 2 101717286 missense probably damaging 1.00
R7672:Prr5l UTSW 2 101734738 missense probably damaging 1.00
R7702:Prr5l UTSW 2 101717097 missense probably benign 0.04
R8086:Prr5l UTSW 2 101741364 missense probably benign 0.00
R8116:Prr5l UTSW 2 101797574 frame shift probably null
R8297:Prr5l UTSW 2 101741285 critical splice donor site probably null
RF028:Prr5l UTSW 2 101797573 frame shift probably null
RF033:Prr5l UTSW 2 101797573 frame shift probably null
RF039:Prr5l UTSW 2 101797573 frame shift probably null
X0018:Prr5l UTSW 2 101717259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCCTGAGTGCATCATGG -3'
(R):5'- TGCTGTAAACAGGTAAAACTGCATG -3'

Sequencing Primer
(F):5'- AGTGCATCATGGTGGCCATC -3'
(R):5'- CTGCATGACATTTAGATAGCCCTG -3'
Posted On2018-08-29