Incidental Mutation 'R6792:Akap2'
ID532628
Institutional Source Beutler Lab
Gene Symbol Akap2
Ensembl Gene ENSMUSG00000038729
Gene NameA kinase (PRKA) anchor protein 2
SynonymsAKAP-KL, B230340M18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001035533; MGI: 1306795

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6792 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location57717657-57896984 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57855880 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 403 (D403G)
Ref Sequence ENSEMBL: ENSMUSP00000103224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043456] [ENSMUST00000098064] [ENSMUST00000098066] [ENSMUST00000102902] [ENSMUST00000102903] [ENSMUST00000107598] [ENSMUST00000107600] [ENSMUST00000124581] [ENSMUST00000126465] [ENSMUST00000132497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043456
AA Change: D403G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048678
Gene: ENSMUSG00000038729
AA Change: D403G

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 568 885 2.5e-17 PFAM
Pfam:RII_binding_1 585 602 1.6e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098064
AA Change: D403G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095672
Gene: ENSMUSG00000038729
AA Change: D403G

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 569 872 4e-13 PFAM
Pfam:RII_binding_1 585 602 2.9e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098066
SMART Domains Protein: ENSMUSP00000095674
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102902
AA Change: D403G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099966
Gene: ENSMUSG00000038729
AA Change: D403G

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:RII_binding_1 585 602 3.5e-5 PFAM
coiled coil region 730 766 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102903
AA Change: D403G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099967
Gene: ENSMUSG00000038729
AA Change: D403G

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:RII_binding_1 585 602 3.5e-5 PFAM
coiled coil region 730 766 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107598
AA Change: D403G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103224
Gene: ENSMUSG00000038729
AA Change: D403G

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 569 872 4e-13 PFAM
Pfam:RII_binding_1 585 602 2.9e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107600
AA Change: D444G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103226
Gene: ENSMUSG00000038729
AA Change: D444G

DomainStartEndE-ValueType
low complexity region 193 204 N/A INTRINSIC
low complexity region 254 268 N/A INTRINSIC
coiled coil region 297 355 N/A INTRINSIC
Pfam:AKAP2_C 636 913 2.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124581
SMART Domains Protein: ENSMUSP00000119742
Gene: ENSMUSG00000038729

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126465
SMART Domains Protein: ENSMUSP00000130230
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132497
Predicted Effect unknown
Transcript: ENSMUST00000150412
AA Change: D646G
SMART Domains Protein: ENSMUSP00000117466
Gene: ENSMUSG00000089945
AA Change: D646G

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 35 59 N/A INTRINSIC
Pfam:Paralemmin 115 269 6.5e-23 PFAM
low complexity region 396 407 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
coiled coil region 499 557 N/A INTRINSIC
Pfam:AKAP2_C 847 1129 1.9e-17 PFAM
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the regulatory subunit of protein kinase A and is found associated with the actin cytoskeleton. The encoded protein mediates signals carried by cAMP and may be involved in creating polarity in certain signaling processes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,115 E316G possibly damaging Het
4932438A13Rik A G 3: 37,011,566 probably null Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Aldh2 C T 5: 121,580,649 G64R probably damaging Het
Atp11a G A 8: 12,861,939 probably benign Het
Bcl11b T C 12: 107,989,734 D52G probably damaging Het
Capg T A 6: 72,555,554 I34K possibly damaging Het
Card11 T A 5: 140,913,309 I37F probably damaging Het
Col27a1 G T 4: 63,317,503 R724L unknown Het
Cryl1 T C 14: 57,382,767 E47G probably damaging Het
Dgkb A T 12: 38,100,425 D70V possibly damaging Het
Dscam T C 16: 96,593,255 E1949G probably damaging Het
Dscam A G 16: 96,648,237 V1387A probably damaging Het
Exph5 G A 9: 53,375,317 V1233M possibly damaging Het
Fat3 A T 9: 16,375,644 V861E probably damaging Het
Fgfr4 T G 13: 55,156,898 D184E possibly damaging Het
Fkbp14 G T 6: 54,585,852 S49* probably null Het
Ginm1 T C 10: 7,773,983 D182G probably damaging Het
Gk2 T C 5: 97,455,729 I417V probably benign Het
Gm21677 A G Y: 3,298,867 Y206H possibly damaging Homo
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Malrd1 C T 2: 16,150,756 P1992L unknown Het
Mapk6 A T 9: 75,395,548 I221N probably damaging Het
Mup9 A G 4: 60,421,355 V65A possibly damaging Het
Myo15b A G 11: 115,885,097 D805G probably damaging Het
Olfr1082 A T 2: 86,593,939 D296E probably benign Het
Olfr69 A G 7: 103,768,139 I86T possibly damaging Het
Otof T A 5: 30,375,634 H1588L probably damaging Het
Pde4a A G 9: 21,192,590 K145R probably benign Het
Pik3ap1 A T 19: 41,321,626 D418E probably benign Het
Pilrb2 C A 5: 137,868,590 R217M possibly damaging Het
Plcb2 T C 2: 118,719,441 N232S probably damaging Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Ppp2r5d A G 17: 46,704,856 S2P probably benign Het
Prr5l T G 2: 101,717,424 N252T probably benign Het
Rilp A T 11: 75,512,775 K348* probably null Het
Slc17a7 A G 7: 45,174,875 E505G possibly damaging Het
Slc6a21 T A 7: 45,279,885 M1K probably null Het
Sorcs1 T C 19: 50,678,168 T101A probably benign Het
Sorl1 A T 9: 42,099,263 V137E probably damaging Het
Stam2 T C 2: 52,707,981 I270V probably benign Het
Synj2 G A 17: 5,990,290 A214T probably benign Het
Tarsl2 G T 7: 65,662,303 C321F probably damaging Het
Tcea1 T A 1: 4,892,045 D229E probably benign Het
Tdrd9 C T 12: 112,027,113 R692W probably benign Het
Tkfc T C 19: 10,594,524 T383A probably benign Het
Traf1 T C 2: 34,956,275 D43G probably benign Het
Tubgcp6 C T 15: 89,122,877 probably benign Het
Vit A T 17: 78,579,399 Y152F probably damaging Het
Vmn1r66 A T 7: 10,274,485 M207K possibly damaging Het
Other mutations in Akap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
A9681:Akap2 UTSW 4 57855358 missense probably damaging 1.00
IGL02835:Akap2 UTSW 4 57883044 missense probably damaging 1.00
R0284:Akap2 UTSW 4 57855207 missense probably damaging 1.00
R0356:Akap2 UTSW 4 57855628 missense possibly damaging 0.48
R0594:Akap2 UTSW 4 57856752 missense probably benign 0.00
R0614:Akap2 UTSW 4 57856720 missense probably benign 0.41
R0617:Akap2 UTSW 4 57829434 intron probably benign
R1228:Akap2 UTSW 4 57856909 missense probably damaging 1.00
R2081:Akap2 UTSW 4 57855927 missense possibly damaging 0.49
R2128:Akap2 UTSW 4 57854890 missense probably benign 0.40
R4667:Akap2 UTSW 4 57855655 missense possibly damaging 0.80
R4804:Akap2 UTSW 4 57854688 missense probably benign 0.05
R4989:Akap2 UTSW 4 57856552 missense probably benign
R5135:Akap2 UTSW 4 57855912 missense probably benign 0.00
R5292:Akap2 UTSW 4 57855356 missense probably damaging 0.98
R5420:Akap2 UTSW 4 57856062 missense probably benign 0.08
R5420:Akap2 UTSW 4 57856434 missense probably damaging 1.00
R5517:Akap2 UTSW 4 57855987 missense probably damaging 0.99
R5648:Akap2 UTSW 4 57854848 missense probably damaging 1.00
R5886:Akap2 UTSW 4 57856295 missense probably damaging 1.00
R5993:Akap2 UTSW 4 57855273 missense possibly damaging 0.86
R6133:Akap2 UTSW 4 57855516 nonsense probably null
R6189:Akap2 UTSW 4 57855928 missense probably benign 0.00
R6221:Akap2 UTSW 4 57855618 nonsense probably null
R6532:Akap2 UTSW 4 57855174 missense probably benign 0.00
R6760:Akap2 UTSW 4 57856026 missense probably damaging 1.00
R7128:Akap2 UTSW 4 57855816 missense probably benign 0.03
R7269:Akap2 UTSW 4 57855217 missense probably damaging 1.00
R7837:Akap2 UTSW 4 57855262 missense probably damaging 1.00
R7940:Akap2 UTSW 4 57883026 missense probably damaging 0.98
R8094:Akap2 UTSW 4 57886319 missense possibly damaging 0.81
R8275:Akap2 UTSW 4 57886329 critical splice donor site probably null
Z1177:Akap2 UTSW 4 57856348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTCACTGAGCAGATTGAC -3'
(R):5'- CTTTGACTACAGTTAGGACGGC -3'

Sequencing Primer
(F):5'- CACTGAGCAGATTGACTTCTCGG -3'
(R):5'- CCCGGGCACTTGTGAACTC -3'
Posted On2018-08-29