Incidental Mutation 'R6792:Aldh2'
ID532637
Institutional Source Beutler Lab
Gene Symbol Aldh2
Ensembl Gene ENSMUSG00000029455
Gene Namealdehyde dehydrogenase 2, mitochondrial
SynonymsAhd5, Ahd-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6792 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121566027-121593824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121580649 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 64 (G64R)
Ref Sequence ENSEMBL: ENSMUSP00000123545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031411] [ENSMUST00000129753] [ENSMUST00000152945] [ENSMUST00000199369]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031411
AA Change: G64R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031411
Gene: ENSMUSG00000029455
AA Change: G64R

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 510 2.9e-185 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000129753
AA Change: G64R

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142906
Gene: ENSMUSG00000029455
AA Change: G64R

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 471 1e-170 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152945
AA Change: G64R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123545
Gene: ENSMUSG00000029455
AA Change: G64R

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 185 1.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199369
SMART Domains Protein: ENSMUSP00000143261
Gene: ENSMUSG00000029455

DomainStartEndE-ValueType
Pfam:Aldedh 1 129 4.2e-43 PFAM
Pfam:Aldedh 125 220 3.6e-36 PFAM
Meta Mutation Damage Score 0.5577 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. Two major liver isoforms of aldehyde dehydrogenase, cytosolic and mitochondrial, can be distinguished by their electrophoretic mobilities, kinetic properties, and subcellular localizations. Most Caucasians have two major isozymes, while approximately 50% of East Asians have the cytosolic isozyme but not the mitochondrial isozyme. A remarkably higher frequency of acute alcohol intoxication among East Asians than among Caucasians could be related to the absence of a catalytically active form of the mitochondrial isozyme. The increased exposure to acetaldehyde in individuals with the catalytically inactive form may also confer greater susceptibility to many types of cancer. This gene encodes a mitochondrial isoform, which has a low Km for acetaldehydes, and is localized in mitochondrial matrix. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutation of this gene results in the absence of oxidation activity in the mitochondria. Mice homozygous for a different allele exhibit decreased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,115 E316G possibly damaging Het
4932438A13Rik A G 3: 37,011,566 probably null Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Akap2 A G 4: 57,855,880 D403G possibly damaging Het
Atp11a G A 8: 12,861,939 probably benign Het
Bcl11b T C 12: 107,989,734 D52G probably damaging Het
Capg T A 6: 72,555,554 I34K possibly damaging Het
Card11 T A 5: 140,913,309 I37F probably damaging Het
Col27a1 G T 4: 63,317,503 R724L unknown Het
Cryl1 T C 14: 57,382,767 E47G probably damaging Het
Dgkb A T 12: 38,100,425 D70V possibly damaging Het
Dscam T C 16: 96,593,255 E1949G probably damaging Het
Dscam A G 16: 96,648,237 V1387A probably damaging Het
Exph5 G A 9: 53,375,317 V1233M possibly damaging Het
Fat3 A T 9: 16,375,644 V861E probably damaging Het
Fgfr4 T G 13: 55,156,898 D184E possibly damaging Het
Fkbp14 G T 6: 54,585,852 S49* probably null Het
Ginm1 T C 10: 7,773,983 D182G probably damaging Het
Gk2 T C 5: 97,455,729 I417V probably benign Het
Gm21677 A G Y: 3,298,867 Y206H possibly damaging Homo
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Malrd1 C T 2: 16,150,756 P1992L unknown Het
Mapk6 A T 9: 75,395,548 I221N probably damaging Het
Mup9 A G 4: 60,421,355 V65A possibly damaging Het
Myo15b A G 11: 115,885,097 D805G probably damaging Het
Olfr1082 A T 2: 86,593,939 D296E probably benign Het
Olfr69 A G 7: 103,768,139 I86T possibly damaging Het
Otof T A 5: 30,375,634 H1588L probably damaging Het
Pde4a A G 9: 21,192,590 K145R probably benign Het
Pik3ap1 A T 19: 41,321,626 D418E probably benign Het
Pilrb2 C A 5: 137,868,590 R217M possibly damaging Het
Plcb2 T C 2: 118,719,441 N232S probably damaging Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Ppp2r5d A G 17: 46,704,856 S2P probably benign Het
Prr5l T G 2: 101,717,424 N252T probably benign Het
Rilp A T 11: 75,512,775 K348* probably null Het
Slc17a7 A G 7: 45,174,875 E505G possibly damaging Het
Slc6a21 T A 7: 45,279,885 M1K probably null Het
Sorcs1 T C 19: 50,678,168 T101A probably benign Het
Sorl1 A T 9: 42,099,263 V137E probably damaging Het
Stam2 T C 2: 52,707,981 I270V probably benign Het
Synj2 G A 17: 5,990,290 A214T probably benign Het
Tarsl2 G T 7: 65,662,303 C321F probably damaging Het
Tcea1 T A 1: 4,892,045 D229E probably benign Het
Tdrd9 C T 12: 112,027,113 R692W probably benign Het
Tkfc T C 19: 10,594,524 T383A probably benign Het
Traf1 T C 2: 34,956,275 D43G probably benign Het
Tubgcp6 C T 15: 89,122,877 probably benign Het
Vit A T 17: 78,579,399 Y152F probably damaging Het
Vmn1r66 A T 7: 10,274,485 M207K possibly damaging Het
Other mutations in Aldh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Aldh2 APN 5 121572073 missense probably benign 0.00
IGL02145:Aldh2 APN 5 121567993 makesense probably null
IGL02352:Aldh2 APN 5 121575897 missense probably null 1.00
IGL02359:Aldh2 APN 5 121575897 missense probably null 1.00
IGL02473:Aldh2 APN 5 121572078 missense probably damaging 1.00
IGL02818:Aldh2 APN 5 121575125 missense probably benign
IGL03182:Aldh2 APN 5 121580724 unclassified probably benign
IGL03324:Aldh2 APN 5 121575125 missense probably benign
Flushed UTSW 5 121572816 nonsense probably null
R0595:Aldh2 UTSW 5 121573500 missense probably damaging 0.99
R0595:Aldh2 UTSW 5 121573501 missense probably damaging 0.97
R1697:Aldh2 UTSW 5 121578341 critical splice donor site probably null
R1992:Aldh2 UTSW 5 121575963 missense possibly damaging 0.93
R2174:Aldh2 UTSW 5 121572668 intron probably benign
R4786:Aldh2 UTSW 5 121572824 missense probably benign 0.21
R4793:Aldh2 UTSW 5 121568979 missense probably damaging 0.99
R5408:Aldh2 UTSW 5 121570557 intron probably benign
R5934:Aldh2 UTSW 5 121579615 missense probably benign
R6266:Aldh2 UTSW 5 121568934 missense probably damaging 0.97
R6294:Aldh2 UTSW 5 121572816 nonsense probably null
R7659:Aldh2 UTSW 5 121568960 missense probably damaging 1.00
X0009:Aldh2 UTSW 5 121572774 missense possibly damaging 0.94
X0027:Aldh2 UTSW 5 121593462 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GAAAGGACCGTCTCAAAACG -3'
(R):5'- GGCACTGATCTACATCTCCG -3'

Sequencing Primer
(F):5'- GCACTGTGTGGTAGCAATACC -3'
(R):5'- TGCTCGGTAGAGCTGAAA -3'
Posted On2018-08-29