Incidental Mutation 'R6792:Card11'
ID532639
Institutional Source Beutler Lab
Gene Symbol Card11
Ensembl Gene ENSMUSG00000036526
Gene Namecaspase recruitment domain family, member 11
SynonymsCARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6792 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location140872990-141000582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140913309 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 37 (I37F)
Ref Sequence ENSEMBL: ENSMUSP00000082941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085786]
Predicted Effect probably damaging
Transcript: ENSMUST00000085786
AA Change: I37F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: I37F

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.3e-23 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
PDZ 674 755 2.73e-1 SMART
Blast:SH3 776 838 1e-10 BLAST
low complexity region 839 850 N/A INTRINSIC
low complexity region 920 934 N/A INTRINSIC
SCOP:d1kjwa2 970 1149 1e-18 SMART
Blast:GuKc 973 1139 1e-102 BLAST
Meta Mutation Damage Score 0.7897 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,115 E316G possibly damaging Het
4932438A13Rik A G 3: 37,011,566 probably null Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Akap2 A G 4: 57,855,880 D403G possibly damaging Het
Aldh2 C T 5: 121,580,649 G64R probably damaging Het
Atp11a G A 8: 12,861,939 probably benign Het
Bcl11b T C 12: 107,989,734 D52G probably damaging Het
Capg T A 6: 72,555,554 I34K possibly damaging Het
Col27a1 G T 4: 63,317,503 R724L unknown Het
Cryl1 T C 14: 57,382,767 E47G probably damaging Het
Dgkb A T 12: 38,100,425 D70V possibly damaging Het
Dscam T C 16: 96,593,255 E1949G probably damaging Het
Dscam A G 16: 96,648,237 V1387A probably damaging Het
Exph5 G A 9: 53,375,317 V1233M possibly damaging Het
Fat3 A T 9: 16,375,644 V861E probably damaging Het
Fgfr4 T G 13: 55,156,898 D184E possibly damaging Het
Fkbp14 G T 6: 54,585,852 S49* probably null Het
Ginm1 T C 10: 7,773,983 D182G probably damaging Het
Gk2 T C 5: 97,455,729 I417V probably benign Het
Gm21677 A G Y: 3,298,867 Y206H possibly damaging Homo
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Malrd1 C T 2: 16,150,756 P1992L unknown Het
Mapk6 A T 9: 75,395,548 I221N probably damaging Het
Mup9 A G 4: 60,421,355 V65A possibly damaging Het
Myo15b A G 11: 115,885,097 D805G probably damaging Het
Olfr1082 A T 2: 86,593,939 D296E probably benign Het
Olfr69 A G 7: 103,768,139 I86T possibly damaging Het
Otof T A 5: 30,375,634 H1588L probably damaging Het
Pde4a A G 9: 21,192,590 K145R probably benign Het
Pik3ap1 A T 19: 41,321,626 D418E probably benign Het
Pilrb2 C A 5: 137,868,590 R217M possibly damaging Het
Plcb2 T C 2: 118,719,441 N232S probably damaging Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Ppp2r5d A G 17: 46,704,856 S2P probably benign Het
Prr5l T G 2: 101,717,424 N252T probably benign Het
Rilp A T 11: 75,512,775 K348* probably null Het
Slc17a7 A G 7: 45,174,875 E505G possibly damaging Het
Slc6a21 T A 7: 45,279,885 M1K probably null Het
Sorcs1 T C 19: 50,678,168 T101A probably benign Het
Sorl1 A T 9: 42,099,263 V137E probably damaging Het
Stam2 T C 2: 52,707,981 I270V probably benign Het
Synj2 G A 17: 5,990,290 A214T probably benign Het
Tarsl2 G T 7: 65,662,303 C321F probably damaging Het
Tcea1 T A 1: 4,892,045 D229E probably benign Het
Tdrd9 C T 12: 112,027,113 R692W probably benign Het
Tkfc T C 19: 10,594,524 T383A probably benign Het
Traf1 T C 2: 34,956,275 D43G probably benign Het
Tubgcp6 C T 15: 89,122,877 probably benign Het
Vit A T 17: 78,579,399 Y152F probably damaging Het
Vmn1r66 A T 7: 10,274,485 M207K possibly damaging Het
Other mutations in Card11
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140897997 intron probably benign
IGL00961:Card11 APN 5 140899709 missense probably damaging 0.97
IGL01645:Card11 APN 5 140878023 missense probably benign 0.00
IGL01731:Card11 APN 5 140882302 missense possibly damaging 0.89
IGL01782:Card11 APN 5 140927726 start codon destroyed probably null 0.02
IGL01935:Card11 APN 5 140883546 missense possibly damaging 0.62
IGL01991:Card11 APN 5 140913378 missense possibly damaging 0.63
IGL02447:Card11 APN 5 140906924 missense possibly damaging 0.93
IGL02583:Card11 APN 5 140878126 missense probably benign 0.10
IGL03255:Card11 APN 5 140898331 missense possibly damaging 0.73
Caravaggio UTSW 5 140913309 missense probably damaging 1.00
Dealer UTSW 5 140885877 missense probably damaging 1.00
hubei UTSW 5 140906767 missense probably damaging 0.96
king UTSW 5 140891080 splice site probably benign
may UTSW 5 140876495 nonsense probably null
Poker UTSW 5 140878082 missense probably benign
Sharp UTSW 5 140876425 missense possibly damaging 0.93
Tumnus UTSW 5 140885945 missense possibly damaging 0.75
unmodulated2 UTSW 5 140883782 splice site probably null
PIT4243001:Card11 UTSW 5 140908604 missense possibly damaging 0.95
PIT4486001:Card11 UTSW 5 140876408 missense probably damaging 1.00
PIT4531001:Card11 UTSW 5 140906660 missense probably damaging 0.99
R0046:Card11 UTSW 5 140908524 missense possibly damaging 0.92
R0285:Card11 UTSW 5 140887101 missense probably damaging 1.00
R0452:Card11 UTSW 5 140880370 missense probably benign 0.01
R1486:Card11 UTSW 5 140876519 missense probably benign
R1710:Card11 UTSW 5 140902905 nonsense probably null
R1733:Card11 UTSW 5 140906633 missense possibly damaging 0.88
R1817:Card11 UTSW 5 140885560 missense probably benign 0.00
R1818:Card11 UTSW 5 140885560 missense probably benign 0.00
R2027:Card11 UTSW 5 140906767 missense probably damaging 0.96
R2436:Card11 UTSW 5 140882362 missense possibly damaging 0.89
R2904:Card11 UTSW 5 140889133 missense probably benign 0.09
R3706:Card11 UTSW 5 140887135 missense probably damaging 0.99
R3708:Card11 UTSW 5 140887135 missense probably damaging 0.99
R4778:Card11 UTSW 5 140883782 splice site probably null
R4877:Card11 UTSW 5 140885877 missense probably damaging 1.00
R4889:Card11 UTSW 5 140885945 missense possibly damaging 0.75
R4910:Card11 UTSW 5 140874414 missense probably damaging 1.00
R5011:Card11 UTSW 5 140876520 missense possibly damaging 0.93
R5257:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5258:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5682:Card11 UTSW 5 140902911 nonsense probably null
R5754:Card11 UTSW 5 140899769 missense probably damaging 0.99
R5873:Card11 UTSW 5 140908638 missense probably damaging 1.00
R6184:Card11 UTSW 5 140898278 missense probably damaging 1.00
R6825:Card11 UTSW 5 140878082 missense probably benign
R7008:Card11 UTSW 5 140873393 missense probably damaging 1.00
R7291:Card11 UTSW 5 140901070 missense probably damaging 1.00
R7376:Card11 UTSW 5 140898238 missense probably benign 0.01
R7526:Card11 UTSW 5 140913429 intron probably null
R7683:Card11 UTSW 5 140896026 missense probably benign
R7730:Card11 UTSW 5 140885996 missense probably damaging 0.96
V7732:Card11 UTSW 5 140876495 nonsense probably null
X0067:Card11 UTSW 5 140885592 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AATAAAAGCCCTCTTCCGGAG -3'
(R):5'- TTTTCAGCGGTATTTGCCAGC -3'

Sequencing Primer
(F):5'- CGGAGGGAGATCGAGCCAATC -3'
(R):5'- CGGTATTTGCCAGCGATCAC -3'
Posted On2018-08-29