Incidental Mutation 'R6792:Fkbp14'
ID532640
Institutional Source Beutler Lab
Gene Symbol Fkbp14
Ensembl Gene ENSMUSG00000038074
Gene NameFK506 binding protein 14
SynonymsFKBP22
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R6792 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location54577604-54597308 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 54585852 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 49 (S49*)
Ref Sequence ENSEMBL: ENSMUSP00000112526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046520] [ENSMUST00000117375] [ENSMUST00000155047]
Predicted Effect probably null
Transcript: ENSMUST00000046520
AA Change: S143*
SMART Domains Protein: ENSMUSP00000046070
Gene: ENSMUSG00000038074
AA Change: S143*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:FKBP_C 38 132 2e-28 PFAM
Pfam:EF-hand_7 116 207 3.7e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117375
AA Change: S49*
SMART Domains Protein: ENSMUSP00000112526
Gene: ENSMUSG00000038074
AA Change: S49*

DomainStartEndE-ValueType
Pfam:FKBP_C 1 38 1.1e-13 PFAM
EFh 45 73 4.08e1 SMART
EFh 89 117 2.56e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155047
SMART Domains Protein: ENSMUSP00000114521
Gene: ENSMUSG00000038074

DomainStartEndE-ValueType
Pfam:FKBP_C 38 117 7.3e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the FK506-binding protein family of peptidyl-prolyl cis-trans isomerases. The encoded protein is found in the lumen of the endoplasmic reticulum, where it is thought to accelerate protein folding. Defects in this gene are a cause of a type of Ehlers-Danlos syndrome (EDS). Both a protein-coding variant and noncoding variants are transcribed from this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,115 E316G possibly damaging Het
4932438A13Rik A G 3: 37,011,566 probably null Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Akap2 A G 4: 57,855,880 D403G possibly damaging Het
Aldh2 C T 5: 121,580,649 G64R probably damaging Het
Atp11a G A 8: 12,861,939 probably benign Het
Bcl11b T C 12: 107,989,734 D52G probably damaging Het
Capg T A 6: 72,555,554 I34K possibly damaging Het
Card11 T A 5: 140,913,309 I37F probably damaging Het
Col27a1 G T 4: 63,317,503 R724L unknown Het
Cryl1 T C 14: 57,382,767 E47G probably damaging Het
Dgkb A T 12: 38,100,425 D70V possibly damaging Het
Dscam T C 16: 96,593,255 E1949G probably damaging Het
Dscam A G 16: 96,648,237 V1387A probably damaging Het
Exph5 G A 9: 53,375,317 V1233M possibly damaging Het
Fat3 A T 9: 16,375,644 V861E probably damaging Het
Fgfr4 T G 13: 55,156,898 D184E possibly damaging Het
Ginm1 T C 10: 7,773,983 D182G probably damaging Het
Gk2 T C 5: 97,455,729 I417V probably benign Het
Gm21677 A G Y: 3,298,867 Y206H possibly damaging Homo
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Malrd1 C T 2: 16,150,756 P1992L unknown Het
Mapk6 A T 9: 75,395,548 I221N probably damaging Het
Mup9 A G 4: 60,421,355 V65A possibly damaging Het
Myo15b A G 11: 115,885,097 D805G probably damaging Het
Olfr1082 A T 2: 86,593,939 D296E probably benign Het
Olfr69 A G 7: 103,768,139 I86T possibly damaging Het
Otof T A 5: 30,375,634 H1588L probably damaging Het
Pde4a A G 9: 21,192,590 K145R probably benign Het
Pik3ap1 A T 19: 41,321,626 D418E probably benign Het
Pilrb2 C A 5: 137,868,590 R217M possibly damaging Het
Plcb2 T C 2: 118,719,441 N232S probably damaging Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Ppp2r5d A G 17: 46,704,856 S2P probably benign Het
Prr5l T G 2: 101,717,424 N252T probably benign Het
Rilp A T 11: 75,512,775 K348* probably null Het
Slc17a7 A G 7: 45,174,875 E505G possibly damaging Het
Slc6a21 T A 7: 45,279,885 M1K probably null Het
Sorcs1 T C 19: 50,678,168 T101A probably benign Het
Sorl1 A T 9: 42,099,263 V137E probably damaging Het
Stam2 T C 2: 52,707,981 I270V probably benign Het
Synj2 G A 17: 5,990,290 A214T probably benign Het
Tarsl2 G T 7: 65,662,303 C321F probably damaging Het
Tcea1 T A 1: 4,892,045 D229E probably benign Het
Tdrd9 C T 12: 112,027,113 R692W probably benign Het
Tkfc T C 19: 10,594,524 T383A probably benign Het
Traf1 T C 2: 34,956,275 D43G probably benign Het
Tubgcp6 C T 15: 89,122,877 probably benign Het
Vit A T 17: 78,579,399 Y152F probably damaging Het
Vmn1r66 A T 7: 10,274,485 M207K possibly damaging Het
Other mutations in Fkbp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02953:Fkbp14 APN 6 54579682 missense probably damaging 1.00
IGL03056:Fkbp14 APN 6 54579544 missense probably benign 0.00
R4178:Fkbp14 UTSW 6 54589314 missense probably damaging 1.00
R4863:Fkbp14 UTSW 6 54585945 splice site probably benign
R4975:Fkbp14 UTSW 6 54592958 missense probably benign 0.01
R5710:Fkbp14 UTSW 6 54589270 splice site probably null
R5714:Fkbp14 UTSW 6 54585850 missense probably damaging 1.00
R6671:Fkbp14 UTSW 6 54579677 missense probably damaging 1.00
R7606:Fkbp14 UTSW 6 54593018 missense probably benign 0.01
R7748:Fkbp14 UTSW 6 54595520 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGATACAAATCAGTCTCAAGGGG -3'
(R):5'- TGTGACCATTGTAGAGCACC -3'

Sequencing Primer
(F):5'- TGGCCACTACTTCTGAGCATGAG -3'
(R):5'- GTAGAGCACCTCTTCATTGAATG -3'
Posted On2018-08-29