Incidental Mutation 'R6792:Capg'
ID532641
Institutional Source Beutler Lab
Gene Symbol Capg
Ensembl Gene ENSMUSG00000056737
Gene Namecapping protein (actin filament), gelsolin-like
SynonymsgCap39, mbh1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R6792 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location72544391-72562983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72555554 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 34 (I34K)
Ref Sequence ENSEMBL: ENSMUSP00000121121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071044] [ENSMUST00000114071] [ENSMUST00000114072] [ENSMUST00000126101] [ENSMUST00000126124] [ENSMUST00000134809] [ENSMUST00000155188] [ENSMUST00000155705]
Predicted Effect probably benign
Transcript: ENSMUST00000071044
AA Change: I34K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000063389
Gene: ENSMUSG00000056737
AA Change: I34K

DomainStartEndE-ValueType
GEL 19 113 8.6e-27 SMART
GEL 136 228 1.86e-31 SMART
GEL 253 348 5.76e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114071
AA Change: I34K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109705
Gene: ENSMUSG00000056737
AA Change: I34K

DomainStartEndE-ValueType
GEL 19 113 8.6e-27 SMART
GEL 136 228 1.86e-31 SMART
GEL 253 348 5.76e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114072
AA Change: I34K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109706
Gene: ENSMUSG00000056737
AA Change: I34K

DomainStartEndE-ValueType
GEL 19 113 8.6e-27 SMART
GEL 136 228 1.86e-31 SMART
GEL 253 348 5.76e-28 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126101
AA Change: I34K

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121121
Gene: ENSMUSG00000056737
AA Change: I34K

DomainStartEndE-ValueType
GEL 19 113 8.6e-27 SMART
GEL 136 228 1.86e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126124
AA Change: I34K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000121221
Gene: ENSMUSG00000056737
AA Change: I34K

DomainStartEndE-ValueType
GEL 19 113 8.6e-27 SMART
GEL 136 193 1.19e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134809
AA Change: I34K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118022
Gene: ENSMUSG00000056737
AA Change: I34K

DomainStartEndE-ValueType
Pfam:Gelsolin 28 90 4.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155188
AA Change: I34K

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120363
Gene: ENSMUSG00000056737
AA Change: I34K

DomainStartEndE-ValueType
GEL 19 113 8.6e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155705
AA Change: I34K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117440
Gene: ENSMUSG00000056737
AA Change: I34K

DomainStartEndE-ValueType
GEL 19 104 1.27e-15 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the gelsolin/villin family of actin-regulatory proteins. The encoded protein reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, the encoded protein contributes to the control of actin-based motility in non-muscle cells. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Inactivation of this loci results in impaired immune cell motility which manifests in homozygous mutant mice as increased susceptibility to some bacterial infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,115 E316G possibly damaging Het
4932438A13Rik A G 3: 37,011,566 probably null Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Akap2 A G 4: 57,855,880 D403G possibly damaging Het
Aldh2 C T 5: 121,580,649 G64R probably damaging Het
Atp11a G A 8: 12,861,939 probably benign Het
Bcl11b T C 12: 107,989,734 D52G probably damaging Het
Card11 T A 5: 140,913,309 I37F probably damaging Het
Col27a1 G T 4: 63,317,503 R724L unknown Het
Cryl1 T C 14: 57,382,767 E47G probably damaging Het
Dgkb A T 12: 38,100,425 D70V possibly damaging Het
Dscam T C 16: 96,593,255 E1949G probably damaging Het
Dscam A G 16: 96,648,237 V1387A probably damaging Het
Exph5 G A 9: 53,375,317 V1233M possibly damaging Het
Fat3 A T 9: 16,375,644 V861E probably damaging Het
Fgfr4 T G 13: 55,156,898 D184E possibly damaging Het
Fkbp14 G T 6: 54,585,852 S49* probably null Het
Ginm1 T C 10: 7,773,983 D182G probably damaging Het
Gk2 T C 5: 97,455,729 I417V probably benign Het
Gm21677 A G Y: 3,298,867 Y206H possibly damaging Homo
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Malrd1 C T 2: 16,150,756 P1992L unknown Het
Mapk6 A T 9: 75,395,548 I221N probably damaging Het
Mup9 A G 4: 60,421,355 V65A possibly damaging Het
Myo15b A G 11: 115,885,097 D805G probably damaging Het
Olfr1082 A T 2: 86,593,939 D296E probably benign Het
Olfr69 A G 7: 103,768,139 I86T possibly damaging Het
Otof T A 5: 30,375,634 H1588L probably damaging Het
Pde4a A G 9: 21,192,590 K145R probably benign Het
Pik3ap1 A T 19: 41,321,626 D418E probably benign Het
Pilrb2 C A 5: 137,868,590 R217M possibly damaging Het
Plcb2 T C 2: 118,719,441 N232S probably damaging Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Ppp2r5d A G 17: 46,704,856 S2P probably benign Het
Prr5l T G 2: 101,717,424 N252T probably benign Het
Rilp A T 11: 75,512,775 K348* probably null Het
Slc17a7 A G 7: 45,174,875 E505G possibly damaging Het
Slc6a21 T A 7: 45,279,885 M1K probably null Het
Sorcs1 T C 19: 50,678,168 T101A probably benign Het
Sorl1 A T 9: 42,099,263 V137E probably damaging Het
Stam2 T C 2: 52,707,981 I270V probably benign Het
Synj2 G A 17: 5,990,290 A214T probably benign Het
Tarsl2 G T 7: 65,662,303 C321F probably damaging Het
Tcea1 T A 1: 4,892,045 D229E probably benign Het
Tdrd9 C T 12: 112,027,113 R692W probably benign Het
Tkfc T C 19: 10,594,524 T383A probably benign Het
Traf1 T C 2: 34,956,275 D43G probably benign Het
Tubgcp6 C T 15: 89,122,877 probably benign Het
Vit A T 17: 78,579,399 Y152F probably damaging Het
Vmn1r66 A T 7: 10,274,485 M207K possibly damaging Het
Other mutations in Capg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02529:Capg APN 6 72555846 missense probably benign 0.01
IGL02569:Capg APN 6 72561049 missense probably damaging 1.00
IGL02613:Capg APN 6 72555611 missense probably damaging 0.99
IGL02629:Capg APN 6 72555754 missense probably benign 0.34
IGL02964:Capg APN 6 72562844 missense probably damaging 0.99
R0014:Capg UTSW 6 72561043 missense possibly damaging 0.95
R1937:Capg UTSW 6 72558253 splice site probably null
R2378:Capg UTSW 6 72555491 missense probably benign 0.07
R4284:Capg UTSW 6 72561099 missense probably damaging 1.00
R5043:Capg UTSW 6 72558254 nonsense probably null
R5233:Capg UTSW 6 72555526 missense probably damaging 1.00
R5955:Capg UTSW 6 72555500 missense probably benign 0.21
R6486:Capg UTSW 6 72557750 nonsense probably null
R7760:Capg UTSW 6 72557786 missense probably damaging 1.00
R8241:Capg UTSW 6 72556253 critical splice donor site probably null
Z1176:Capg UTSW 6 72555476 critical splice acceptor site probably null
Z1177:Capg UTSW 6 72556230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTCTACTTCCAAGGGCTG -3'
(R):5'- ACTGCTGGCCTAAGGTGAAC -3'

Sequencing Primer
(F):5'- TCCAAGGGCTGCTCCTC -3'
(R):5'- CTGGCCTAAGGTGAACAGGAG -3'
Posted On2018-08-29