Incidental Mutation 'R6792:1700123L14Rik'
ID532642
Institutional Source Beutler Lab
Gene Symbol 1700123L14Rik
Ensembl Gene ENSMUSG00000072878
Gene NameRIKEN cDNA 1700123L14 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R6792 (G1)
Quality Score148.008
Status Not validated
Chromosome6
Chromosomal Location96164497-96166243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96165115 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 316 (E316G)
Ref Sequence ENSEMBL: ENSMUSP00000087515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075080] [ENSMUST00000090061] [ENSMUST00000122120]
Predicted Effect probably benign
Transcript: ENSMUST00000075080
SMART Domains Protein: ENSMUSP00000074589
Gene: ENSMUSG00000059187

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 40 129 3.9e-60 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090061
AA Change: E316G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087515
Gene: ENSMUSG00000072878
AA Change: E316G

DomainStartEndE-ValueType
Pfam:NUP50 2 73 1.8e-15 PFAM
low complexity region 84 94 N/A INTRINSIC
RanBD 315 438 2.69e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122120
SMART Domains Protein: ENSMUSP00000113152
Gene: ENSMUSG00000059187

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 41 129 4e-50 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,011,566 probably null Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Akap2 A G 4: 57,855,880 D403G possibly damaging Het
Aldh2 C T 5: 121,580,649 G64R probably damaging Het
Atp11a G A 8: 12,861,939 probably benign Het
Bcl11b T C 12: 107,989,734 D52G probably damaging Het
Capg T A 6: 72,555,554 I34K possibly damaging Het
Card11 T A 5: 140,913,309 I37F probably damaging Het
Col27a1 G T 4: 63,317,503 R724L unknown Het
Cryl1 T C 14: 57,382,767 E47G probably damaging Het
Dgkb A T 12: 38,100,425 D70V possibly damaging Het
Dscam T C 16: 96,593,255 E1949G probably damaging Het
Dscam A G 16: 96,648,237 V1387A probably damaging Het
Exph5 G A 9: 53,375,317 V1233M possibly damaging Het
Fat3 A T 9: 16,375,644 V861E probably damaging Het
Fgfr4 T G 13: 55,156,898 D184E possibly damaging Het
Fkbp14 G T 6: 54,585,852 S49* probably null Het
Ginm1 T C 10: 7,773,983 D182G probably damaging Het
Gk2 T C 5: 97,455,729 I417V probably benign Het
Gm21677 A G Y: 3,298,867 Y206H possibly damaging Homo
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Malrd1 C T 2: 16,150,756 P1992L unknown Het
Mapk6 A T 9: 75,395,548 I221N probably damaging Het
Mup9 A G 4: 60,421,355 V65A possibly damaging Het
Myo15b A G 11: 115,885,097 D805G probably damaging Het
Olfr1082 A T 2: 86,593,939 D296E probably benign Het
Olfr69 A G 7: 103,768,139 I86T possibly damaging Het
Otof T A 5: 30,375,634 H1588L probably damaging Het
Pde4a A G 9: 21,192,590 K145R probably benign Het
Pik3ap1 A T 19: 41,321,626 D418E probably benign Het
Pilrb2 C A 5: 137,868,590 R217M possibly damaging Het
Plcb2 T C 2: 118,719,441 N232S probably damaging Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Ppp2r5d A G 17: 46,704,856 S2P probably benign Het
Prr5l T G 2: 101,717,424 N252T probably benign Het
Rilp A T 11: 75,512,775 K348* probably null Het
Slc17a7 A G 7: 45,174,875 E505G possibly damaging Het
Slc6a21 T A 7: 45,279,885 M1K probably null Het
Sorcs1 T C 19: 50,678,168 T101A probably benign Het
Sorl1 A T 9: 42,099,263 V137E probably damaging Het
Stam2 T C 2: 52,707,981 I270V probably benign Het
Synj2 G A 17: 5,990,290 A214T probably benign Het
Tarsl2 G T 7: 65,662,303 C321F probably damaging Het
Tcea1 T A 1: 4,892,045 D229E probably benign Het
Tdrd9 C T 12: 112,027,113 R692W probably benign Het
Tkfc T C 19: 10,594,524 T383A probably benign Het
Traf1 T C 2: 34,956,275 D43G probably benign Het
Tubgcp6 C T 15: 89,122,877 probably benign Het
Vit A T 17: 78,579,399 Y152F probably damaging Het
Vmn1r66 A T 7: 10,274,485 M207K possibly damaging Het
Other mutations in 1700123L14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:1700123L14Rik APN 6 96165694 missense possibly damaging 0.48
IGL02347:1700123L14Rik APN 6 96165530 missense probably damaging 1.00
IGL02532:1700123L14Rik APN 6 96164790 missense probably damaging 0.99
PIT4283001:1700123L14Rik UTSW 6 96165715 missense probably benign
R0282:1700123L14Rik UTSW 6 96164816 missense probably benign 0.02
R0946:1700123L14Rik UTSW 6 96165696 missense possibly damaging 0.68
R1275:1700123L14Rik UTSW 6 96165118 missense probably benign 0.03
R1605:1700123L14Rik UTSW 6 96164812 missense probably benign 0.34
R1610:1700123L14Rik UTSW 6 96165289 missense probably damaging 0.98
R1959:1700123L14Rik UTSW 6 96165269 missense possibly damaging 0.73
R1961:1700123L14Rik UTSW 6 96165269 missense possibly damaging 0.73
R2116:1700123L14Rik UTSW 6 96164860 missense probably damaging 0.99
R3708:1700123L14Rik UTSW 6 96165952 missense possibly damaging 0.92
R4157:1700123L14Rik UTSW 6 96165283 missense possibly damaging 0.86
R4285:1700123L14Rik UTSW 6 96165752 missense probably benign 0.07
R4571:1700123L14Rik UTSW 6 96164881 missense probably damaging 1.00
R4884:1700123L14Rik UTSW 6 96164812 missense probably damaging 1.00
R4905:1700123L14Rik UTSW 6 96165930 missense possibly damaging 0.77
R6454:1700123L14Rik UTSW 6 96165628 missense possibly damaging 0.75
R6755:1700123L14Rik UTSW 6 96164972 missense probably benign 0.06
R6790:1700123L14Rik UTSW 6 96165323 missense probably benign
R6931:1700123L14Rik UTSW 6 96165548 missense possibly damaging 0.86
R7081:1700123L14Rik UTSW 6 96165817 missense possibly damaging 0.68
R7194:1700123L14Rik UTSW 6 96164775 missense probably benign 0.04
R7584:1700123L14Rik UTSW 6 96165392 missense probably benign 0.41
R7938:1700123L14Rik UTSW 6 96164885 missense possibly damaging 0.66
R7983:1700123L14Rik UTSW 6 96165907 missense probably damaging 0.96
R8052:1700123L14Rik UTSW 6 96165097 intron probably benign
R8052:1700123L14Rik UTSW 6 96165103 intron probably benign
R8303:1700123L14Rik UTSW 6 96165721 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AACATGGCATATCGGGTGGG -3'
(R):5'- AACACTGAAACCCCGGCTTG -3'

Sequencing Primer
(F):5'- CAGGAGTATGCTGCCTAACTTAG -3'
(R):5'- TGGGGTTCCCTCAACTCTGG -3'
Posted On2018-08-29