Incidental Mutation 'R6792:Tarsl2'
ID532647
Institutional Source Beutler Lab
Gene Symbol Tarsl2
Ensembl Gene ENSMUSG00000030515
Gene Namethreonyl-tRNA synthetase-like 2
SynonymsA530046H20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R6792 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location65644898-65692091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65662303 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 321 (C321F)
Ref Sequence ENSEMBL: ENSMUSP00000032728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032728]
Predicted Effect probably damaging
Transcript: ENSMUST00000032728
AA Change: C321F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032728
Gene: ENSMUSG00000030515
AA Change: C321F

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
coiled coil region 44 68 N/A INTRINSIC
Pfam:TGS 151 210 8.8e-14 PFAM
tRNA_SAD 316 365 1.26e-16 SMART
Pfam:tRNA-synt_2b 464 675 2.2e-35 PFAM
Pfam:HGTP_anticodon 687 778 1.1e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,115 E316G possibly damaging Het
4932438A13Rik A G 3: 37,011,566 probably null Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Akap2 A G 4: 57,855,880 D403G possibly damaging Het
Aldh2 C T 5: 121,580,649 G64R probably damaging Het
Atp11a G A 8: 12,861,939 probably benign Het
Bcl11b T C 12: 107,989,734 D52G probably damaging Het
Capg T A 6: 72,555,554 I34K possibly damaging Het
Card11 T A 5: 140,913,309 I37F probably damaging Het
Col27a1 G T 4: 63,317,503 R724L unknown Het
Cryl1 T C 14: 57,382,767 E47G probably damaging Het
Dgkb A T 12: 38,100,425 D70V possibly damaging Het
Dscam T C 16: 96,593,255 E1949G probably damaging Het
Dscam A G 16: 96,648,237 V1387A probably damaging Het
Exph5 G A 9: 53,375,317 V1233M possibly damaging Het
Fat3 A T 9: 16,375,644 V861E probably damaging Het
Fgfr4 T G 13: 55,156,898 D184E possibly damaging Het
Fkbp14 G T 6: 54,585,852 S49* probably null Het
Ginm1 T C 10: 7,773,983 D182G probably damaging Het
Gk2 T C 5: 97,455,729 I417V probably benign Het
Gm21677 A G Y: 3,298,867 Y206H possibly damaging Homo
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Malrd1 C T 2: 16,150,756 P1992L unknown Het
Mapk6 A T 9: 75,395,548 I221N probably damaging Het
Mup9 A G 4: 60,421,355 V65A possibly damaging Het
Myo15b A G 11: 115,885,097 D805G probably damaging Het
Olfr1082 A T 2: 86,593,939 D296E probably benign Het
Olfr69 A G 7: 103,768,139 I86T possibly damaging Het
Otof T A 5: 30,375,634 H1588L probably damaging Het
Pde4a A G 9: 21,192,590 K145R probably benign Het
Pik3ap1 A T 19: 41,321,626 D418E probably benign Het
Pilrb2 C A 5: 137,868,590 R217M possibly damaging Het
Plcb2 T C 2: 118,719,441 N232S probably damaging Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Ppp2r5d A G 17: 46,704,856 S2P probably benign Het
Prr5l T G 2: 101,717,424 N252T probably benign Het
Rilp A T 11: 75,512,775 K348* probably null Het
Slc17a7 A G 7: 45,174,875 E505G possibly damaging Het
Slc6a21 T A 7: 45,279,885 M1K probably null Het
Sorcs1 T C 19: 50,678,168 T101A probably benign Het
Sorl1 A T 9: 42,099,263 V137E probably damaging Het
Stam2 T C 2: 52,707,981 I270V probably benign Het
Synj2 G A 17: 5,990,290 A214T probably benign Het
Tcea1 T A 1: 4,892,045 D229E probably benign Het
Tdrd9 C T 12: 112,027,113 R692W probably benign Het
Tkfc T C 19: 10,594,524 T383A probably benign Het
Traf1 T C 2: 34,956,275 D43G probably benign Het
Tubgcp6 C T 15: 89,122,877 probably benign Het
Vit A T 17: 78,579,399 Y152F probably damaging Het
Vmn1r66 A T 7: 10,274,485 M207K possibly damaging Het
Other mutations in Tarsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Tarsl2 APN 7 65652259 critical splice acceptor site probably null
IGL00470:Tarsl2 APN 7 65688908 missense probably benign 0.03
IGL00594:Tarsl2 APN 7 65676132 critical splice donor site probably null
IGL01352:Tarsl2 APN 7 65658910 missense possibly damaging 0.80
IGL01519:Tarsl2 APN 7 65663886 missense probably damaging 1.00
IGL01726:Tarsl2 APN 7 65682818 missense possibly damaging 0.46
IGL02370:Tarsl2 APN 7 65661165 missense probably benign 0.17
IGL02729:Tarsl2 APN 7 65682819 missense probably damaging 0.97
IGL03234:Tarsl2 APN 7 65652278 missense probably benign 0.06
gary UTSW 7 65688952 critical splice donor site probably null
smart_money UTSW 7 65678142 missense probably damaging 1.00
R0127:Tarsl2 UTSW 7 65664969 missense probably benign 0.19
R0153:Tarsl2 UTSW 7 65684081 missense probably damaging 1.00
R0605:Tarsl2 UTSW 7 65678071 missense probably damaging 1.00
R1070:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R1450:Tarsl2 UTSW 7 65647496 missense probably benign 0.01
R1467:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R1467:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R2142:Tarsl2 UTSW 7 65658897 missense probably benign
R2143:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2144:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2145:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2208:Tarsl2 UTSW 7 65682848 missense probably damaging 1.00
R3713:Tarsl2 UTSW 7 65688952 critical splice donor site probably null
R3715:Tarsl2 UTSW 7 65688952 critical splice donor site probably null
R3914:Tarsl2 UTSW 7 65683808 missense probably benign 0.05
R3929:Tarsl2 UTSW 7 65684043 splice site probably null
R4008:Tarsl2 UTSW 7 65678128 missense probably damaging 1.00
R4064:Tarsl2 UTSW 7 65652270 missense possibly damaging 0.90
R4367:Tarsl2 UTSW 7 65682819 missense probably damaging 0.97
R4652:Tarsl2 UTSW 7 65689969 missense probably damaging 1.00
R4825:Tarsl2 UTSW 7 65647554 missense probably benign 0.38
R4901:Tarsl2 UTSW 7 65691294 missense probably benign 0.05
R4999:Tarsl2 UTSW 7 65658935 missense probably damaging 0.99
R5423:Tarsl2 UTSW 7 65683819 missense probably benign 0.00
R5756:Tarsl2 UTSW 7 65675976 missense probably benign 0.22
R5772:Tarsl2 UTSW 7 65684125 missense probably damaging 1.00
R6160:Tarsl2 UTSW 7 65682779 missense probably benign 0.32
R6230:Tarsl2 UTSW 7 65686436 splice site probably null
R6424:Tarsl2 UTSW 7 65655739 missense probably damaging 1.00
R6615:Tarsl2 UTSW 7 65678142 missense probably damaging 1.00
R7350:Tarsl2 UTSW 7 65658924 missense probably damaging 1.00
R7549:Tarsl2 UTSW 7 65647593 missense probably damaging 0.96
R7592:Tarsl2 UTSW 7 65658871 missense probably benign 0.01
R7634:Tarsl2 UTSW 7 65676012 missense probably damaging 0.99
R7710:Tarsl2 UTSW 7 65664969 missense probably benign 0.19
R7808:Tarsl2 UTSW 7 65652261 missense probably benign 0.01
R7875:Tarsl2 UTSW 7 65678151 missense probably benign 0.05
R8254:Tarsl2 UTSW 7 65676061 missense probably benign
Z1177:Tarsl2 UTSW 7 65652264 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCACAGATGCGTCCACTG -3'
(R):5'- GACACTTCTAGCCTCTGCAAAG -3'

Sequencing Primer
(F):5'- TGCGTCCACTGACCAACCTG -3'
(R):5'- AGATAAATCTTTGAGAAATGGCCG -3'
Posted On2018-08-29