Incidental Mutation 'R6792:Fgfr4'
ID532661
Institutional Source Beutler Lab
Gene Symbol Fgfr4
Ensembl Gene ENSMUSG00000005320
Gene Namefibroblast growth factor receptor 4
SynonymsFgfr-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6792 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location55152640-55168759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 55156898 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 184 (D184E)
Ref Sequence ENSEMBL: ENSMUSP00000005452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005452
AA Change: D184E

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320
AA Change: D184E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,115 E316G possibly damaging Het
4932438A13Rik A G 3: 37,011,566 probably null Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Akap2 A G 4: 57,855,880 D403G possibly damaging Het
Aldh2 C T 5: 121,580,649 G64R probably damaging Het
Atp11a G A 8: 12,861,939 probably benign Het
Bcl11b T C 12: 107,989,734 D52G probably damaging Het
Capg T A 6: 72,555,554 I34K possibly damaging Het
Card11 T A 5: 140,913,309 I37F probably damaging Het
Col27a1 G T 4: 63,317,503 R724L unknown Het
Cryl1 T C 14: 57,382,767 E47G probably damaging Het
Dgkb A T 12: 38,100,425 D70V possibly damaging Het
Dscam T C 16: 96,593,255 E1949G probably damaging Het
Dscam A G 16: 96,648,237 V1387A probably damaging Het
Exph5 G A 9: 53,375,317 V1233M possibly damaging Het
Fat3 A T 9: 16,375,644 V861E probably damaging Het
Fkbp14 G T 6: 54,585,852 S49* probably null Het
Ginm1 T C 10: 7,773,983 D182G probably damaging Het
Gk2 T C 5: 97,455,729 I417V probably benign Het
Gm21677 A G Y: 3,298,867 Y206H possibly damaging Homo
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Malrd1 C T 2: 16,150,756 P1992L unknown Het
Mapk6 A T 9: 75,395,548 I221N probably damaging Het
Mup9 A G 4: 60,421,355 V65A possibly damaging Het
Myo15b A G 11: 115,885,097 D805G probably damaging Het
Olfr1082 A T 2: 86,593,939 D296E probably benign Het
Olfr69 A G 7: 103,768,139 I86T possibly damaging Het
Otof T A 5: 30,375,634 H1588L probably damaging Het
Pde4a A G 9: 21,192,590 K145R probably benign Het
Pik3ap1 A T 19: 41,321,626 D418E probably benign Het
Pilrb2 C A 5: 137,868,590 R217M possibly damaging Het
Plcb2 T C 2: 118,719,441 N232S probably damaging Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Ppp2r5d A G 17: 46,704,856 S2P probably benign Het
Prr5l T G 2: 101,717,424 N252T probably benign Het
Rilp A T 11: 75,512,775 K348* probably null Het
Slc17a7 A G 7: 45,174,875 E505G possibly damaging Het
Slc6a21 T A 7: 45,279,885 M1K probably null Het
Sorcs1 T C 19: 50,678,168 T101A probably benign Het
Sorl1 A T 9: 42,099,263 V137E probably damaging Het
Stam2 T C 2: 52,707,981 I270V probably benign Het
Synj2 G A 17: 5,990,290 A214T probably benign Het
Tarsl2 G T 7: 65,662,303 C321F probably damaging Het
Tcea1 T A 1: 4,892,045 D229E probably benign Het
Tdrd9 C T 12: 112,027,113 R692W probably benign Het
Tkfc T C 19: 10,594,524 T383A probably benign Het
Traf1 T C 2: 34,956,275 D43G probably benign Het
Tubgcp6 C T 15: 89,122,877 probably benign Het
Vit A T 17: 78,579,399 Y152F probably damaging Het
Vmn1r66 A T 7: 10,274,485 M207K possibly damaging Het
Other mutations in Fgfr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55159170 missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55161179 missense probably benign
IGL02817:Fgfr4 APN 13 55156668 critical splice donor site probably null
interference UTSW 13 55165964 missense probably damaging 1.00
Modest UTSW 13 55166251 missense probably damaging 1.00
offense UTSW 13 55161515 missense possibly damaging 0.81
R0153:Fgfr4 UTSW 13 55161385 splice site probably benign
R0727:Fgfr4 UTSW 13 55156228 splice site probably null
R1646:Fgfr4 UTSW 13 55165964 missense probably damaging 1.00
R1749:Fgfr4 UTSW 13 55167792 splice site probably null
R1993:Fgfr4 UTSW 13 55165902 missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55167889 missense possibly damaging 0.51
R2152:Fgfr4 UTSW 13 55166964 missense probably damaging 1.00
R2386:Fgfr4 UTSW 13 55167901 missense probably benign 0.36
R3086:Fgfr4 UTSW 13 55167392 splice site probably benign
R3939:Fgfr4 UTSW 13 55156494 missense probably null 0.96
R4255:Fgfr4 UTSW 13 55166251 missense probably damaging 1.00
R4463:Fgfr4 UTSW 13 55156467 missense probably benign 0.02
R4510:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4511:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55168170 missense unknown
R5133:Fgfr4 UTSW 13 55160015 missense probably damaging 1.00
R5146:Fgfr4 UTSW 13 55165912 missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55167417 missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55156651 missense probably benign
R5927:Fgfr4 UTSW 13 55166887 missense probably damaging 1.00
R6318:Fgfr4 UTSW 13 55166108 missense probably damaging 1.00
R7018:Fgfr4 UTSW 13 55166200 missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55161449 missense probably benign 0.00
R7343:Fgfr4 UTSW 13 55159155 missense probably damaging 1.00
R7808:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R7891:Fgfr4 UTSW 13 55159151 missense probably benign 0.22
Z1177:Fgfr4 UTSW 13 55161707 missense probably damaging 1.00
Z1177:Fgfr4 UTSW 13 55165929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCCACCTGGTCACTGAG -3'
(R):5'- TGGGAAGTTGCACTTTGTAAGAAG -3'

Sequencing Primer
(F):5'- CCTGGTCACTGAGGAGAGACTTG -3'
(R):5'- GCACTTTGTAAGAAGAACTTGAGCC -3'
Posted On2018-08-29