Incidental Mutation 'R6792:Ppp2r5d'
ID532667
Institutional Source Beutler Lab
Gene Symbol Ppp2r5d
Ensembl Gene ENSMUSG00000059409
Gene Nameprotein phosphatase 2, regulatory subunit B', delta
SynonymsTEG-271, B'delta, Tex271
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R6792 (G1)
Quality Score143.008
Status Validated
Chromosome17
Chromosomal Location46682991-46705002 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46704856 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2 (S2P)
Ref Sequence ENSEMBL: ENSMUSP00000002839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002839]
Predicted Effect probably benign
Transcript: ENSMUST00000002839
AA Change: S2P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002839
Gene: ENSMUSG00000059409
AA Change: S2P

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
Pfam:B56 95 505 6.2e-201 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a delta isoform of the regulatory subunit B56 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trap allele exhibit lethality, while heterozygous mice display decreased prepulse inhibition. Mice homozygous for a targeted knock-out allele exhibit decreased thermal nociception threshold, impaired coordination, and increasedlatency to removing an adhesive sticker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,115 E316G possibly damaging Het
4932438A13Rik A G 3: 37,011,566 probably null Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Akap2 A G 4: 57,855,880 D403G possibly damaging Het
Aldh2 C T 5: 121,580,649 G64R probably damaging Het
Atp11a G A 8: 12,861,939 probably benign Het
Bcl11b T C 12: 107,989,734 D52G probably damaging Het
Capg T A 6: 72,555,554 I34K possibly damaging Het
Card11 T A 5: 140,913,309 I37F probably damaging Het
Col27a1 G T 4: 63,317,503 R724L unknown Het
Cryl1 T C 14: 57,382,767 E47G probably damaging Het
Dgkb A T 12: 38,100,425 D70V possibly damaging Het
Dscam T C 16: 96,593,255 E1949G probably damaging Het
Dscam A G 16: 96,648,237 V1387A probably damaging Het
Exph5 G A 9: 53,375,317 V1233M possibly damaging Het
Fat3 A T 9: 16,375,644 V861E probably damaging Het
Fgfr4 T G 13: 55,156,898 D184E possibly damaging Het
Fkbp14 G T 6: 54,585,852 S49* probably null Het
Ginm1 T C 10: 7,773,983 D182G probably damaging Het
Gk2 T C 5: 97,455,729 I417V probably benign Het
Gm21677 A G Y: 3,298,867 Y206H possibly damaging Homo
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Malrd1 C T 2: 16,150,756 P1992L unknown Het
Mapk6 A T 9: 75,395,548 I221N probably damaging Het
Mup9 A G 4: 60,421,355 V65A possibly damaging Het
Myo15b A G 11: 115,885,097 D805G probably damaging Het
Olfr1082 A T 2: 86,593,939 D296E probably benign Het
Olfr69 A G 7: 103,768,139 I86T possibly damaging Het
Otof T A 5: 30,375,634 H1588L probably damaging Het
Pde4a A G 9: 21,192,590 K145R probably benign Het
Pik3ap1 A T 19: 41,321,626 D418E probably benign Het
Pilrb2 C A 5: 137,868,590 R217M possibly damaging Het
Plcb2 T C 2: 118,719,441 N232S probably damaging Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Prr5l T G 2: 101,717,424 N252T probably benign Het
Rilp A T 11: 75,512,775 K348* probably null Het
Slc17a7 A G 7: 45,174,875 E505G possibly damaging Het
Slc6a21 T A 7: 45,279,885 M1K probably null Het
Sorcs1 T C 19: 50,678,168 T101A probably benign Het
Sorl1 A T 9: 42,099,263 V137E probably damaging Het
Stam2 T C 2: 52,707,981 I270V probably benign Het
Synj2 G A 17: 5,990,290 A214T probably benign Het
Tarsl2 G T 7: 65,662,303 C321F probably damaging Het
Tcea1 T A 1: 4,892,045 D229E probably benign Het
Tdrd9 C T 12: 112,027,113 R692W probably benign Het
Tkfc T C 19: 10,594,524 T383A probably benign Het
Traf1 T C 2: 34,956,275 D43G probably benign Het
Tubgcp6 C T 15: 89,122,877 probably benign Het
Vit A T 17: 78,579,399 Y152F probably damaging Het
Vmn1r66 A T 7: 10,274,485 M207K possibly damaging Het
Other mutations in Ppp2r5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Ppp2r5d APN 17 46685517 critical splice donor site probably null
IGL01570:Ppp2r5d APN 17 46687917 missense possibly damaging 0.64
IGL02504:Ppp2r5d APN 17 46700093 missense probably benign 0.34
R0620:Ppp2r5d UTSW 17 46684018 missense probably benign
R0665:Ppp2r5d UTSW 17 46686404 missense probably damaging 1.00
R1584:Ppp2r5d UTSW 17 46684684 missense probably benign 0.45
R1989:Ppp2r5d UTSW 17 46684099 missense probably benign 0.00
R4261:Ppp2r5d UTSW 17 46687081 nonsense probably null
R5577:Ppp2r5d UTSW 17 46687975 missense probably benign 0.00
R5717:Ppp2r5d UTSW 17 46687894 missense probably damaging 0.99
R6266:Ppp2r5d UTSW 17 46685703 splice site probably null
R6491:Ppp2r5d UTSW 17 46685583 missense probably damaging 1.00
R7060:Ppp2r5d UTSW 17 46687353 missense possibly damaging 0.63
R7100:Ppp2r5d UTSW 17 46685682 missense probably benign 0.03
R7197:Ppp2r5d UTSW 17 46685601 missense probably damaging 0.99
R7231:Ppp2r5d UTSW 17 46684060 missense probably benign 0.00
R7237:Ppp2r5d UTSW 17 46686280 missense possibly damaging 0.86
R7420:Ppp2r5d UTSW 17 46687581 missense probably null 1.00
R7832:Ppp2r5d UTSW 17 46684546 missense probably benign 0.00
R8129:Ppp2r5d UTSW 17 46684337 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATCTGTCCGGGCAAAGACG -3'
(R):5'- AATGACCAATCCGAGGAGGC -3'

Sequencing Primer
(F):5'- TGTCCCAGCTGCTGCAC -3'
(R):5'- GCGGCTCCTGGTTCTCAG -3'
Posted On2018-08-29