Incidental Mutation 'R6793:Mapk4'
ID532721
Institutional Source Beutler Lab
Gene Symbol Mapk4
Ensembl Gene ENSMUSG00000024558
Gene Namemitogen-activated protein kinase 4
SynonymsErk3-related, p63Mapk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6793 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location73928486-74065359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73930468 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 561 (N561I)
Ref Sequence ENSEMBL: ENSMUSP00000089462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091851] [ENSMUST00000159162] [ENSMUST00000162863]
Predicted Effect probably damaging
Transcript: ENSMUST00000091851
AA Change: N561I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089462
Gene: ENSMUSG00000024558
AA Change: N561I

DomainStartEndE-ValueType
S_TKc 20 312 3.81e-79 SMART
low complexity region 462 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159162
SMART Domains Protein: ENSMUSP00000123922
Gene: ENSMUSG00000024558

DomainStartEndE-ValueType
Pfam:Pkinase 20 232 2.3e-58 PFAM
Pfam:Pkinase_Tyr 22 232 5.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162863
SMART Domains Protein: ENSMUSP00000124408
Gene: ENSMUSG00000024558

DomainStartEndE-ValueType
Pfam:Pkinase 20 192 1.7e-41 PFAM
Pfam:Pkinase_Tyr 22 189 5.9e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase 4 is a member of the mitogen-activated protein kinase family. Tyrosine kinase growth factor receptors activate mitogen-activated protein kinases which then translocate into the nucleus and phosphorylate nuclear targets. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viabel and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A C 14: 32,806,821 I48L probably benign Het
2010315B03Rik A T 9: 124,295,422 N19K possibly damaging Het
A2ml1 G A 6: 128,546,329 Q1215* probably null Het
Abraxas2 T C 7: 132,874,834 I98T probably damaging Het
Ankrd17 G A 5: 90,265,512 T1181I probably damaging Het
Bsn T A 9: 108,114,615 K1313* probably null Het
C130060K24Rik C T 6: 65,381,421 A43V probably benign Het
Chst4 A T 8: 110,030,067 V388D probably damaging Het
Ckap5 T G 2: 91,568,709 W613G probably damaging Het
Clock GACTCACT GACT 5: 76,237,120 probably null Het
Enpp1 T C 10: 24,655,825 D520G probably damaging Het
Epha3 T C 16: 63,773,455 N90S probably benign Het
Esp36 A T 17: 38,417,114 M92K unknown Het
Fam135a A G 1: 24,067,925 V44A possibly damaging Het
Fndc8 T C 11: 82,897,586 S81P probably damaging Het
Fsip2 T G 2: 82,989,494 N5190K probably benign Het
Gabrr1 T G 4: 33,162,712 V426G possibly damaging Het
Igkv6-15 T A 6: 70,406,992 M1L probably benign Het
Lrrc36 A G 8: 105,458,433 E614G probably damaging Het
Man1a2 A T 3: 100,632,597 I176K possibly damaging Het
Med15 A T 16: 17,652,703 probably benign Het
Mfsd2a A G 4: 122,950,705 V258A probably benign Het
Micu3 G A 8: 40,380,695 V457I probably damaging Het
Mov10l1 T A 15: 88,996,184 V291E possibly damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ncbp1 T C 4: 46,157,827 I355T probably damaging Het
Olfr571 A G 7: 102,909,728 V37A probably benign Het
Olfr600 T C 7: 103,346,266 T221A probably benign Het
Otub2 A G 12: 103,389,019 probably benign Het
Pcdh15 T C 10: 74,631,139 S1666P probably damaging Het
Pcdha12 T A 18: 37,022,181 V651E probably damaging Het
Pomt1 T C 2: 32,242,949 F186L probably damaging Het
Prl3d3 G A 13: 27,161,061 A140T probably benign Het
Ptprn G A 1: 75,258,142 T267I probably benign Het
Rhbdd2 T A 5: 135,636,154 I113N probably damaging Het
Saraf T A 8: 34,168,613 probably null Het
Slc41a2 T C 10: 83,301,158 probably null Het
Slc47a1 A G 11: 61,359,403 V352A probably benign Het
Tmem237 T C 1: 59,114,216 T49A probably benign Het
Tmprss11e C T 5: 86,715,555 C217Y probably damaging Het
Ubfd1 T C 7: 122,067,880 V140A probably benign Het
Utrn A G 10: 12,640,925 probably null Het
Utrn T A 10: 12,699,100 I1028F possibly damaging Het
Virma C T 4: 11,539,968 T1479M probably damaging Het
Vwa7 G T 17: 35,024,891 R767L probably benign Het
Wdfy3 A T 5: 101,917,431 Y1290* probably null Het
Zfp970 G A 2: 177,475,545 C304Y probably damaging Het
Other mutations in Mapk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02396:Mapk4 APN 18 73933997 intron probably null
IGL02621:Mapk4 APN 18 73970275 missense probably damaging 1.00
IGL03068:Mapk4 APN 18 73970344 missense probably damaging 1.00
R0041:Mapk4 UTSW 18 73935038 missense probably damaging 1.00
R0519:Mapk4 UTSW 18 73970321 missense probably damaging 1.00
R0636:Mapk4 UTSW 18 73930454 missense probably benign
R0918:Mapk4 UTSW 18 73970337 missense probably damaging 1.00
R1654:Mapk4 UTSW 18 73930939 missense probably damaging 1.00
R2913:Mapk4 UTSW 18 73935165 missense probably benign 0.34
R2914:Mapk4 UTSW 18 73935165 missense probably benign 0.34
R4089:Mapk4 UTSW 18 73930459 missense probably damaging 1.00
R4414:Mapk4 UTSW 18 73930538 missense possibly damaging 0.76
R4487:Mapk4 UTSW 18 73930975 missense probably damaging 1.00
R4792:Mapk4 UTSW 18 73937250 missense probably damaging 0.98
R5445:Mapk4 UTSW 18 73931002 missense probably benign 0.00
R5597:Mapk4 UTSW 18 73937270 missense probably benign 0.12
R5654:Mapk4 UTSW 18 73970294 missense probably damaging 1.00
R6700:Mapk4 UTSW 18 73930811 missense probably damaging 1.00
R7200:Mapk4 UTSW 18 73930919 missense possibly damaging 0.92
R7335:Mapk4 UTSW 18 73937267 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TTCTGCTAACCCCAACGCAG -3'
(R):5'- ATTGCACAGTGGGTCAAGAGC -3'

Sequencing Primer
(F):5'- CCCAACGCAGCAGAGAGG -3'
(R):5'- CACACAAAGTGGCTCTGAGCG -3'
Posted On2018-08-29