Incidental Mutation 'R6743:Gm14295'
ID 532729
Institutional Source Beutler Lab
Gene Symbol Gm14295
Ensembl Gene ENSMUSG00000078877
Gene Name predicted gene 14295
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock # R6743 (G1)
Quality Score 126.008
Status Not validated
Chromosome 2
Chromosomal Location 176798612-176811223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 176810627 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 637 (C637G)
Ref Sequence ENSEMBL: ENSMUSP00000119262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118012] [ENSMUST00000132883] [ENSMUST00000179435]
AlphaFold A2BG91
Predicted Effect probably benign
Transcript: ENSMUST00000118012
SMART Domains Protein: ENSMUSP00000113133
Gene: ENSMUSG00000078877

DomainStartEndE-ValueType
KRAB 4 64 5.2e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132883
AA Change: C637G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119262
Gene: ENSMUSG00000078877
AA Change: C637G

DomainStartEndE-ValueType
KRAB 4 66 6.97e-14 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 1.67e-2 SMART
ZnF_C2H2 159 181 2.27e-4 SMART
ZnF_C2H2 187 209 2.61e-4 SMART
ZnF_C2H2 215 237 5.5e-3 SMART
ZnF_C2H2 243 265 2.4e-3 SMART
ZnF_C2H2 271 293 6.32e-3 SMART
ZnF_C2H2 299 321 4.17e-3 SMART
ZnF_C2H2 327 349 3.21e-4 SMART
ZnF_C2H2 355 377 6.88e-4 SMART
ZnF_C2H2 383 405 9.22e-5 SMART
ZnF_C2H2 411 433 6.88e-4 SMART
ZnF_C2H2 439 461 9.22e-5 SMART
ZnF_C2H2 467 489 1.67e-2 SMART
ZnF_C2H2 495 517 3.16e-3 SMART
ZnF_C2H2 523 545 1.3e-4 SMART
ZnF_C2H2 551 573 1.67e-2 SMART
ZnF_C2H2 579 601 3.16e-3 SMART
ZnF_C2H2 607 629 6.78e-3 SMART
ZnF_C2H2 635 657 4.54e-4 SMART
ZnF_C2H2 663 685 4.54e-4 SMART
ZnF_C2H2 691 713 1.67e-2 SMART
ZnF_C2H2 719 741 3.16e-3 SMART
ZnF_C2H2 747 769 1.38e-3 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 823 8.75e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179435
SMART Domains Protein: ENSMUSP00000136320
Gene: ENSMUSG00000078877

DomainStartEndE-ValueType
KRAB 3 63 5.2e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,108,347 R339C possibly damaging Het
Adamts6 G A 13: 104,428,928 G721R probably damaging Het
Adnp2 A G 18: 80,128,059 V1045A probably benign Het
Agbl3 T C 6: 34,846,953 I856T probably benign Het
Anapc1 T A 2: 128,684,534 K115* probably null Het
Arc A G 15: 74,671,787 S196P probably benign Het
Atp10a T C 7: 58,797,814 I768T possibly damaging Het
Blk C T 14: 63,384,926 R55H probably benign Het
Ccdc105 G A 10: 78,752,892 T28M probably benign Het
Ccdc158 T C 5: 92,662,146 S168G probably benign Het
Cda G T 4: 138,338,942 T128K probably benign Het
Celsr1 T A 15: 85,907,598 T2601S probably damaging Het
Dmxl1 T C 18: 49,880,780 V1545A possibly damaging Het
Dst T A 1: 34,270,890 N6264K probably damaging Het
Ednra T C 8: 77,675,089 S191G probably damaging Het
Elk3 A T 10: 93,265,050 S280T possibly damaging Het
Etnk1 A G 6: 143,180,617 I63V possibly damaging Het
Fscb A G 12: 64,471,573 S1040P unknown Het
Gm5114 T C 7: 39,408,573 T541A probably benign Het
Man2c1 T C 9: 57,135,565 F240L probably benign Het
Map2 A T 1: 66,415,607 I1219L probably benign Het
Map3k13 A G 16: 21,892,423 Y152C probably damaging Het
Mettl7a3 A G 15: 100,335,242 K105E probably benign Het
Morc1 G A 16: 48,502,320 A327T probably damaging Het
Myo3a A T 2: 22,361,664 Y553F probably benign Het
Myo9b T A 8: 71,352,159 probably null Het
Olfr125 A C 17: 37,835,803 D268A probably damaging Het
Olfr1469 C T 19: 13,410,593 T8I probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pde6a T A 18: 61,263,986 F634L possibly damaging Het
Pkd1l2 C A 8: 117,030,631 C1556F probably damaging Het
Prdm5 G A 6: 65,883,651 V440I probably damaging Het
Rasa2 T C 9: 96,611,440 T64A probably damaging Het
Sec24b A T 3: 130,041,232 Y106N probably damaging Het
Sfswap C T 5: 129,550,819 Q689* probably null Het
Slamf8 C T 1: 172,590,398 probably null Het
Tsr1 T C 11: 74,908,351 V786A probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zmynd10 T C 9: 107,547,880 I58T possibly damaging Het
Other mutations in Gm14295
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1623:Gm14295 UTSW 2 176807364 missense probably damaging 1.00
R2061:Gm14295 UTSW 2 176810681 nonsense probably null
R2172:Gm14295 UTSW 2 176811102 missense possibly damaging 0.48
R2411:Gm14295 UTSW 2 176807413 missense probably benign 0.29
R4472:Gm14295 UTSW 2 176809593 missense possibly damaging 0.71
R4949:Gm14295 UTSW 2 176809676 missense probably damaging 0.99
R5082:Gm14295 UTSW 2 176807417 nonsense probably null
R5311:Gm14295 UTSW 2 176810672 missense probably benign 0.00
R5792:Gm14295 UTSW 2 176811014 missense probably benign 0.10
R6170:Gm14295 UTSW 2 176811144 unclassified probably benign
R6267:Gm14295 UTSW 2 176808989 nonsense probably null
R6286:Gm14295 UTSW 2 176809568 missense possibly damaging 0.52
R7456:Gm14295 UTSW 2 176809150 missense possibly damaging 0.95
R7536:Gm14295 UTSW 2 176810929 missense possibly damaging 0.74
R8049:Gm14295 UTSW 2 176809078 missense probably benign 0.03
R8126:Gm14295 UTSW 2 176810865 missense probably benign 0.04
R8209:Gm14295 UTSW 2 176811177 missense unknown
R8292:Gm14295 UTSW 2 176809558 missense probably damaging 0.99
R8356:Gm14295 UTSW 2 176809514 missense probably benign 0.24
R8412:Gm14295 UTSW 2 176809629 missense probably damaging 1.00
R8993:Gm14295 UTSW 2 176809830 missense possibly damaging 0.48
R9459:Gm14295 UTSW 2 176807372 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCTTTGCAAGAAGTGGTGACC -3'
(R):5'- TTTCTGCAAAGGCTTTACCACA -3'

Sequencing Primer
(F):5'- GTGGTAAAGCCTTTGCACATAGC -3'
(R):5'- GCTATGTGCAAAGGCTTTACCAC -3'
Posted On 2018-08-29