Incidental Mutation 'R6743:Ccdc158'
ID532732
Institutional Source Beutler Lab
Gene Symbol Ccdc158
Ensembl Gene ENSMUSG00000050050
Gene Namecoiled-coil domain containing 158
Synonyms4932413O14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R6743 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92607954-92675271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92662146 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 168 (S168G)
Ref Sequence ENSEMBL: ENSMUSP00000117894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060930] [ENSMUST00000150359] [ENSMUST00000151180]
Predicted Effect probably benign
Transcript: ENSMUST00000060930
AA Change: S168G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000063050
Gene: ENSMUSG00000050050
AA Change: S168G

DomainStartEndE-ValueType
Pfam:CCDC158 1 1109 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150359
AA Change: S168G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123259
Gene: ENSMUSG00000050050
AA Change: S168G

DomainStartEndE-ValueType
Pfam:CCDC158 1 346 1.5e-220 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151180
AA Change: S168G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117894
Gene: ENSMUSG00000050050
AA Change: S168G

DomainStartEndE-ValueType
coiled coil region 71 105 N/A INTRINSIC
coiled coil region 127 166 N/A INTRINSIC
coiled coil region 244 343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,108,347 R339C possibly damaging Het
Adamts6 G A 13: 104,428,928 G721R probably damaging Het
Adnp2 A G 18: 80,128,059 V1045A probably benign Het
Agbl3 T C 6: 34,846,953 I856T probably benign Het
Anapc1 T A 2: 128,684,534 K115* probably null Het
Arc A G 15: 74,671,787 S196P probably benign Het
Atp10a T C 7: 58,797,814 I768T possibly damaging Het
Blk C T 14: 63,384,926 R55H probably benign Het
Ccdc105 G A 10: 78,752,892 T28M probably benign Het
Cda G T 4: 138,338,942 T128K probably benign Het
Celsr1 T A 15: 85,907,598 T2601S probably damaging Het
Dmxl1 T C 18: 49,880,780 V1545A possibly damaging Het
Dst T A 1: 34,270,890 N6264K probably damaging Het
Ednra T C 8: 77,675,089 S191G probably damaging Het
Elk3 A T 10: 93,265,050 S280T possibly damaging Het
Etnk1 A G 6: 143,180,617 I63V possibly damaging Het
Fscb A G 12: 64,471,573 S1040P unknown Het
Gm14295 T G 2: 176,810,627 C637G probably damaging Het
Gm5114 T C 7: 39,408,573 T541A probably benign Het
Man2c1 T C 9: 57,135,565 F240L probably benign Het
Map2 A T 1: 66,415,607 I1219L probably benign Het
Map3k13 A G 16: 21,892,423 Y152C probably damaging Het
Mettl7a3 A G 15: 100,335,242 K105E probably benign Het
Morc1 G A 16: 48,502,320 A327T probably damaging Het
Myo3a A T 2: 22,361,664 Y553F probably benign Het
Myo9b T A 8: 71,352,159 probably null Het
Olfr125 A C 17: 37,835,803 D268A probably damaging Het
Olfr1469 C T 19: 13,410,593 T8I probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pde6a T A 18: 61,263,986 F634L possibly damaging Het
Pkd1l2 C A 8: 117,030,631 C1556F probably damaging Het
Prdm5 G A 6: 65,883,651 V440I probably damaging Het
Rasa2 T C 9: 96,611,440 T64A probably damaging Het
Sec24b A T 3: 130,041,232 Y106N probably damaging Het
Sfswap C T 5: 129,550,819 Q689* probably null Het
Slamf8 C T 1: 172,590,398 probably null Het
Tsr1 T C 11: 74,908,351 V786A probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zmynd10 T C 9: 107,547,880 I58T possibly damaging Het
Other mutations in Ccdc158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ccdc158 APN 5 92657881 missense probably benign 0.01
IGL00926:Ccdc158 APN 5 92650767 missense probably damaging 0.98
IGL01533:Ccdc158 APN 5 92609956 splice site probably null
IGL01551:Ccdc158 APN 5 92666761 missense probably damaging 0.96
IGL01591:Ccdc158 APN 5 92662041 missense probably benign 0.28
IGL01722:Ccdc158 APN 5 92662739 missense possibly damaging 0.93
IGL02250:Ccdc158 APN 5 92608478 missense probably damaging 1.00
IGL02457:Ccdc158 APN 5 92650048 missense probably damaging 1.00
IGL02570:Ccdc158 APN 5 92649026 missense possibly damaging 0.81
IGL02951:Ccdc158 APN 5 92650006 missense probably damaging 1.00
IGL03275:Ccdc158 APN 5 92629632 missense probably benign 0.00
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0747:Ccdc158 UTSW 5 92633297 missense probably benign 0.00
R1219:Ccdc158 UTSW 5 92654181 splice site probably benign
R1480:Ccdc158 UTSW 5 92649044 missense probably damaging 1.00
R1926:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R2172:Ccdc158 UTSW 5 92632508 missense probably damaging 1.00
R2245:Ccdc158 UTSW 5 92609952 unclassified probably benign
R3004:Ccdc158 UTSW 5 92649070 missense probably damaging 1.00
R3147:Ccdc158 UTSW 5 92657963 missense probably damaging 1.00
R3693:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3694:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3735:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3736:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3912:Ccdc158 UTSW 5 92648935 missense possibly damaging 0.90
R4026:Ccdc158 UTSW 5 92643807 missense probably benign 0.07
R4080:Ccdc158 UTSW 5 92623396 missense probably benign 0.00
R4463:Ccdc158 UTSW 5 92634300 missense probably null 0.99
R4483:Ccdc158 UTSW 5 92633328 missense probably benign 0.01
R4859:Ccdc158 UTSW 5 92633403 missense probably damaging 0.99
R5016:Ccdc158 UTSW 5 92657892 missense probably benign 0.01
R5050:Ccdc158 UTSW 5 92666879 missense probably benign 0.01
R5372:Ccdc158 UTSW 5 92632560 missense possibly damaging 0.55
R5427:Ccdc158 UTSW 5 92648962 missense probably damaging 1.00
R5847:Ccdc158 UTSW 5 92627480 missense probably benign 0.00
R5966:Ccdc158 UTSW 5 92650049 missense probably damaging 1.00
R6106:Ccdc158 UTSW 5 92627466 missense probably benign
R6185:Ccdc158 UTSW 5 92666854 missense possibly damaging 0.73
R6562:Ccdc158 UTSW 5 92662722 missense probably damaging 0.99
R6815:Ccdc158 UTSW 5 92612486 missense probably damaging 0.99
R6914:Ccdc158 UTSW 5 92662070 missense probably benign 0.00
R6975:Ccdc158 UTSW 5 92666720 nonsense probably null
R7252:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R7477:Ccdc158 UTSW 5 92650696 missense probably damaging 0.96
R7782:Ccdc158 UTSW 5 92645514 missense probably benign 0.00
R8014:Ccdc158 UTSW 5 92649030 missense probably damaging 1.00
R8018:Ccdc158 UTSW 5 92623401 missense possibly damaging 0.64
X0025:Ccdc158 UTSW 5 92662012 missense probably benign
Z1176:Ccdc158 UTSW 5 92608491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTTTACTAATAGCTGAGCCCAG -3'
(R):5'- GCCATGGCTGATATCAGGTTGG -3'

Sequencing Primer
(F):5'- CAGGCTGCGGAAGTGCATG -3'
(R):5'- TCCACAAGTGCTAGAGCTTG -3'
Posted On2018-08-29