Mutagenetix > Incidental Mutation

Incidental Mutation 'R6743:Sfswap'

532733

Institutional Source

Beutler Lab

Gene Symbol

Sfswap

Ensembl Gene

ENSMUSG00000029439

Gene Name

splicing factor SWAP

Synonyms

Sfrs8, 6330437E22Rik, 1190005N23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6743 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

129501221-129571384 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 129550819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 689 (Q689*)

Ref Sequence

ENSEMBL: ENSMUSP00000062413 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698]

AlphaFold

Q3USH5

Predicted Effect

probably null
Transcript: ENSMUST00000053737
AA Change: Q689*

SMART Domains

Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439
AA Change: Q689*

Domain	Start	End	E-Value	Type
low complexity region	22	30	N/A	INTRINSIC
DRY_EERY	33	157	1.15e-57	SMART
low complexity region	160	170	N/A	INTRINSIC
low complexity region	174	186	N/A	INTRINSIC
SWAP	209	262	3.94e-19	SMART
low complexity region	286	293	N/A	INTRINSIC
low complexity region	333	352	N/A	INTRINSIC
low complexity region	397	441	N/A	INTRINSIC
SWAP	456	507	9.55e-18	SMART
low complexity region	513	532	N/A	INTRINSIC
low complexity region	548	562	N/A	INTRINSIC
low complexity region	598	607	N/A	INTRINSIC
coiled coil region	631	686	N/A	INTRINSIC
low complexity region	741	788	N/A	INTRINSIC
low complexity region	797	821	N/A	INTRINSIC
low complexity region	840	865	N/A	INTRINSIC
low complexity region	871	888	N/A	INTRINSIC
low complexity region	889	905	N/A	INTRINSIC
low complexity region	909	920	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196698

SMART Domains

Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

Domain	Start	End	E-Value	Type
low complexity region	22	30	N/A	INTRINSIC
DRY_EERY	33	121	1.8e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199215

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg1	C	T	17: 31,108,347	R339C	possibly damaging	Het
Adamts6	G	A	13: 104,428,928	G721R	probably damaging	Het
Adnp2	A	G	18: 80,128,059	V1045A	probably benign	Het
Agbl3	T	C	6: 34,846,953	I856T	probably benign	Het
Anapc1	T	A	2: 128,684,534	K115*	probably null	Het
Arc	A	G	15: 74,671,787	S196P	probably benign	Het
Atp10a	T	C	7: 58,797,814	I768T	possibly damaging	Het
Blk	C	T	14: 63,384,926	R55H	probably benign	Het
Ccdc105	G	A	10: 78,752,892	T28M	probably benign	Het
Ccdc158	T	C	5: 92,662,146	S168G	probably benign	Het
Cda	G	T	4: 138,338,942	T128K	probably benign	Het
Celsr1	T	A	15: 85,907,598	T2601S	probably damaging	Het
Dmxl1	T	C	18: 49,880,780	V1545A	possibly damaging	Het
Dst	T	A	1: 34,270,890	N6264K	probably damaging	Het
Ednra	T	C	8: 77,675,089	S191G	probably damaging	Het
Elk3	A	T	10: 93,265,050	S280T	possibly damaging	Het
Etnk1	A	G	6: 143,180,617	I63V	possibly damaging	Het
Fscb	A	G	12: 64,471,573	S1040P	unknown	Het
Gm14295	T	G	2: 176,810,627	C637G	probably damaging	Het
Gm5114	T	C	7: 39,408,573	T541A	probably benign	Het
Man2c1	T	C	9: 57,135,565	F240L	probably benign	Het
Map2	A	T	1: 66,415,607	I1219L	probably benign	Het
Map3k13	A	G	16: 21,892,423	Y152C	probably damaging	Het
Mettl7a3	A	G	15: 100,335,242	K105E	probably benign	Het
Morc1	G	A	16: 48,502,320	A327T	probably damaging	Het
Myo3a	A	T	2: 22,361,664	Y553F	probably benign	Het
Myo9b	T	A	8: 71,352,159		probably null	Het
Olfr125	A	C	17: 37,835,803	D268A	probably damaging	Het
Olfr1469	C	T	19: 13,410,593	T8I	probably damaging	Het
Pam	A	G	1: 97,896,049	V219A	probably benign	Het
Panx1	A	G	9: 15,007,633	I310T	possibly damaging	Het
Pde6a	T	A	18: 61,263,986	F634L	possibly damaging	Het
Pkd1l2	C	A	8: 117,030,631	C1556F	probably damaging	Het
Prdm5	G	A	6: 65,883,651	V440I	probably damaging	Het
Rasa2	T	C	9: 96,611,440	T64A	probably damaging	Het
Sec24b	A	T	3: 130,041,232	Y106N	probably damaging	Het
Slamf8	C	T	1: 172,590,398		probably null	Het
Tsr1	T	C	11: 74,908,351	V786A	probably benign	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zmynd10	T	C	9: 107,547,880	I58T	possibly damaging	Het

Other mutations in Sfswap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00740:Sfswap	APN	5	129513233	missense	probably damaging	1.00
IGL02064:Sfswap	APN	5	129560796	missense	probably benign	0.17
IGL02083:Sfswap	APN	5	129539791	missense	probably benign
IGL02378:Sfswap	APN	5	129539604	missense	probably damaging	1.00
FR4340:Sfswap	UTSW	5	129569751	unclassified	probably benign
FR4342:Sfswap	UTSW	5	129569757	unclassified	probably benign
FR4449:Sfswap	UTSW	5	129569748	unclassified	probably benign
FR4449:Sfswap	UTSW	5	129569749	unclassified	probably benign
FR4548:Sfswap	UTSW	5	129569749	unclassified	probably benign
FR4548:Sfswap	UTSW	5	129569755	unclassified	probably benign
FR4737:Sfswap	UTSW	5	129569756	unclassified	probably benign
FR4976:Sfswap	UTSW	5	129569751	unclassified	probably benign
I1329:Sfswap	UTSW	5	129507137	unclassified	probably benign
P0033:Sfswap	UTSW	5	129539755	missense	possibly damaging	0.60
R0184:Sfswap	UTSW	5	129507189	missense	probably damaging	0.97
R0233:Sfswap	UTSW	5	129554543	missense	possibly damaging	0.82
R0233:Sfswap	UTSW	5	129554543	missense	possibly damaging	0.82
R0414:Sfswap	UTSW	5	129504051	missense	possibly damaging	0.83
R0415:Sfswap	UTSW	5	129504126	missense	probably damaging	1.00
R0570:Sfswap	UTSW	5	129503978	splice site	probably benign
R1018:Sfswap	UTSW	5	129554576	missense	possibly damaging	0.91
R1173:Sfswap	UTSW	5	129507143	critical splice acceptor site	probably null
R1298:Sfswap	UTSW	5	129541378	missense	probably benign	0.14
R1723:Sfswap	UTSW	5	129539694	missense	probably benign
R1783:Sfswap	UTSW	5	129513240	missense	possibly damaging	0.92
R1828:Sfswap	UTSW	5	129513084	missense	probably damaging	1.00
R1879:Sfswap	UTSW	5	129541328	missense	probably benign	0.01
R2078:Sfswap	UTSW	5	129516107	missense	possibly damaging	0.81
R2349:Sfswap	UTSW	5	129569738	missense	possibly damaging	0.87
R3757:Sfswap	UTSW	5	129513234	missense	probably damaging	1.00
R4093:Sfswap	UTSW	5	129560741	missense	possibly damaging	0.85
R4094:Sfswap	UTSW	5	129560741	missense	possibly damaging	0.85
R4095:Sfswap	UTSW	5	129560741	missense	possibly damaging	0.85
R4785:Sfswap	UTSW	5	129513083	missense	probably damaging	1.00
R5139:Sfswap	UTSW	5	129571009	missense	possibly damaging	0.73
R5355:Sfswap	UTSW	5	129539746	missense	probably benign	0.09
R5481:Sfswap	UTSW	5	129514818	missense	probably damaging	0.98
R5600:Sfswap	UTSW	5	129513158	missense	probably damaging	1.00
R5686:Sfswap	UTSW	5	129514818	missense	probably damaging	0.98
R5906:Sfswap	UTSW	5	129542043	missense	probably benign	0.22
R6332:Sfswap	UTSW	5	129571041	missense	possibly damaging	0.91
R6738:Sfswap	UTSW	5	129541441	missense	probably damaging	0.98
R7371:Sfswap	UTSW	5	129543241	missense	probably benign	0.01
R7747:Sfswap	UTSW	5	129550593	splice site	probably null
R8286:Sfswap	UTSW	5	129539719	missense	probably damaging	0.99
R8738:Sfswap	UTSW	5	129543281	missense	possibly damaging	0.52
R8943:Sfswap	UTSW	5	129504104	missense	probably damaging	1.00
R9119:Sfswap	UTSW	5	129514765	missense	probably benign
R9587:Sfswap	UTSW	5	129541363	missense	probably benign	0.00
R9601:Sfswap	UTSW	5	129541399	missense	possibly damaging	0.94
R9718:Sfswap	UTSW	5	129539784	missense	probably benign
RF003:Sfswap	UTSW	5	129569764	unclassified	probably benign
RF042:Sfswap	UTSW	5	129569743	unclassified	probably benign
RF049:Sfswap	UTSW	5	129569744	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCAGAAGGTGCCTATGAAAAC -3'
(R):5'- AAAGTCTGTGACTATGCTGGAG -3'

Sequencing Primer
(F):5'- CCAGAAATGAAATGCCACTTGC -3'
(R):5'- GCTGGAGGCAGGTGTTG -3'

Posted On

2018-08-29