Mutagenetix > Incidental Mutation

Incidental Mutation 'R6743:Agbl3'

532734

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

044860-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6743 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34846953 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 856 (I856T)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably benign
Transcript: ENSMUST00000115016
AA Change: I856T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: I856T

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115017
AA Change: I851T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: I851T

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (39/39)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg1	C	T	17: 31,108,347	R339C	possibly damaging	Het
Adamts6	G	A	13: 104,428,928	G721R	probably damaging	Het
Adnp2	A	G	18: 80,128,059	V1045A	probably benign	Het
Anapc1	T	A	2: 128,684,534	K115*	probably null	Het
Arc	A	G	15: 74,671,787	S196P	probably benign	Het
Atp10a	T	C	7: 58,797,814	I768T	possibly damaging	Het
Blk	C	T	14: 63,384,926	R55H	probably benign	Het
Ccdc105	G	A	10: 78,752,892	T28M	probably benign	Het
Ccdc158	T	C	5: 92,662,146	S168G	probably benign	Het
Cda	G	T	4: 138,338,942	T128K	probably benign	Het
Celsr1	T	A	15: 85,907,598	T2601S	probably damaging	Het
Dmxl1	T	C	18: 49,880,780	V1545A	possibly damaging	Het
Dst	T	A	1: 34,270,890	N6264K	probably damaging	Het
Ednra	T	C	8: 77,675,089	S191G	probably damaging	Het
Elk3	A	T	10: 93,265,050	S280T	possibly damaging	Het
Etnk1	A	G	6: 143,180,617	I63V	possibly damaging	Het
Fscb	A	G	12: 64,471,573	S1040P	unknown	Het
Gm14295	T	G	2: 176,810,627	C637G	probably damaging	Het
Gm5114	T	C	7: 39,408,573	T541A	probably benign	Het
Man2c1	T	C	9: 57,135,565	F240L	probably benign	Het
Map2	A	T	1: 66,415,607	I1219L	probably benign	Het
Map3k13	A	G	16: 21,892,423	Y152C	probably damaging	Het
Mettl7a3	A	G	15: 100,335,242	K105E	probably benign	Het
Morc1	G	A	16: 48,502,320	A327T	probably damaging	Het
Myo3a	A	T	2: 22,361,664	Y553F	probably benign	Het
Myo9b	T	A	8: 71,352,159		probably null	Het
Olfr125	A	C	17: 37,835,803	D268A	probably damaging	Het
Olfr1469	C	T	19: 13,410,593	T8I	probably damaging	Het
Pam	A	G	1: 97,896,049	V219A	probably benign	Het
Panx1	A	G	9: 15,007,633	I310T	possibly damaging	Het
Pde6a	T	A	18: 61,263,986	F634L	possibly damaging	Het
Pkd1l2	C	A	8: 117,030,631	C1556F	probably damaging	Het
Prdm5	G	A	6: 65,883,651	V440I	probably damaging	Het
Rasa2	T	C	9: 96,611,440	T64A	probably damaging	Het
Sec24b	A	T	3: 130,041,232	Y106N	probably damaging	Het
Sfswap	C	T	5: 129,550,819	Q689*	probably null	Het
Slamf8	C	T	1: 172,590,398		probably null	Het
Tsr1	T	C	11: 74,908,351	V786A	probably benign	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zmynd10	T	C	9: 107,547,880	I58T	possibly damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTGCTCCCTAGAGTCACATC -3'
(R):5'- TAATGACCTAACAAGCCGTGCTTC -3'

Sequencing Primer
(F):5'- TCCCTAGAGTCACATCACCAGTTG -3'
(R):5'- CAAGCCGTGCTTCCTTATAAAACTG -3'

Posted On

2018-08-29