Incidental Mutation 'R6743:Agbl3'
ID532734
Institutional Source Beutler Lab
Gene Symbol Agbl3
Ensembl Gene ENSMUSG00000038836
Gene NameATP/GTP binding protein-like 3
Synonyms4930431N21Rik, 2900053G10Rik, 6530406M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6743 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location34780432-34859459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34846953 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 856 (I856T)
Ref Sequence ENSEMBL: ENSMUSP00000110668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]
Predicted Effect probably benign
Transcript: ENSMUST00000115016
AA Change: I856T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: I856T

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115017
AA Change: I851T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: I851T

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148834
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,108,347 R339C possibly damaging Het
Adamts6 G A 13: 104,428,928 G721R probably damaging Het
Adnp2 A G 18: 80,128,059 V1045A probably benign Het
Anapc1 T A 2: 128,684,534 K115* probably null Het
Arc A G 15: 74,671,787 S196P probably benign Het
Atp10a T C 7: 58,797,814 I768T possibly damaging Het
Blk C T 14: 63,384,926 R55H probably benign Het
Ccdc105 G A 10: 78,752,892 T28M probably benign Het
Ccdc158 T C 5: 92,662,146 S168G probably benign Het
Cda G T 4: 138,338,942 T128K probably benign Het
Celsr1 T A 15: 85,907,598 T2601S probably damaging Het
Dmxl1 T C 18: 49,880,780 V1545A possibly damaging Het
Dst T A 1: 34,270,890 N6264K probably damaging Het
Ednra T C 8: 77,675,089 S191G probably damaging Het
Elk3 A T 10: 93,265,050 S280T possibly damaging Het
Etnk1 A G 6: 143,180,617 I63V possibly damaging Het
Fscb A G 12: 64,471,573 S1040P unknown Het
Gm14295 T G 2: 176,810,627 C637G probably damaging Het
Gm5114 T C 7: 39,408,573 T541A probably benign Het
Man2c1 T C 9: 57,135,565 F240L probably benign Het
Map2 A T 1: 66,415,607 I1219L probably benign Het
Map3k13 A G 16: 21,892,423 Y152C probably damaging Het
Mettl7a3 A G 15: 100,335,242 K105E probably benign Het
Morc1 G A 16: 48,502,320 A327T probably damaging Het
Myo3a A T 2: 22,361,664 Y553F probably benign Het
Myo9b T A 8: 71,352,159 probably null Het
Olfr125 A C 17: 37,835,803 D268A probably damaging Het
Olfr1469 C T 19: 13,410,593 T8I probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pde6a T A 18: 61,263,986 F634L possibly damaging Het
Pkd1l2 C A 8: 117,030,631 C1556F probably damaging Het
Prdm5 G A 6: 65,883,651 V440I probably damaging Het
Rasa2 T C 9: 96,611,440 T64A probably damaging Het
Sec24b A T 3: 130,041,232 Y106N probably damaging Het
Sfswap C T 5: 129,550,819 Q689* probably null Het
Slamf8 C T 1: 172,590,398 probably null Het
Tsr1 T C 11: 74,908,351 V786A probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zmynd10 T C 9: 107,547,880 I58T possibly damaging Het
Other mutations in Agbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Agbl3 APN 6 34846836 missense probably damaging 1.00
IGL00835:Agbl3 APN 6 34799732 missense probably damaging 1.00
IGL00840:Agbl3 APN 6 34799159 missense possibly damaging 0.95
IGL01090:Agbl3 APN 6 34799887 missense probably benign 0.40
IGL01123:Agbl3 APN 6 34846976 nonsense probably null
IGL01707:Agbl3 APN 6 34839454 missense possibly damaging 0.78
IGL01728:Agbl3 APN 6 34782157 start codon destroyed probably null
IGL02335:Agbl3 APN 6 34799750 missense probably damaging 1.00
IGL02420:Agbl3 APN 6 34785307 missense possibly damaging 0.47
IGL02551:Agbl3 APN 6 34823071 missense possibly damaging 0.88
IGL02974:Agbl3 APN 6 34799822 missense probably damaging 1.00
IGL03167:Agbl3 APN 6 34857659 missense possibly damaging 0.92
IGL03182:Agbl3 APN 6 34803500 missense probably damaging 1.00
R0044:Agbl3 UTSW 6 34799899 missense probably damaging 1.00
R0499:Agbl3 UTSW 6 34839335 missense probably benign
R0639:Agbl3 UTSW 6 34799705 missense probably damaging 1.00
R0850:Agbl3 UTSW 6 34799204 missense probably damaging 1.00
R1004:Agbl3 UTSW 6 34803451 missense probably damaging 0.99
R1080:Agbl3 UTSW 6 34828235 missense probably benign 0.14
R1589:Agbl3 UTSW 6 34857517 missense possibly damaging 0.77
R2361:Agbl3 UTSW 6 34832505 missense possibly damaging 0.87
R2495:Agbl3 UTSW 6 34846764 missense probably damaging 1.00
R3236:Agbl3 UTSW 6 34823087 splice site probably null
R3237:Agbl3 UTSW 6 34823087 splice site probably null
R3420:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3421:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3422:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3810:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R3811:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R4059:Agbl3 UTSW 6 34846899 missense probably damaging 1.00
R4499:Agbl3 UTSW 6 34857598 missense probably benign 0.00
R4687:Agbl3 UTSW 6 34798326 missense probably damaging 1.00
R4854:Agbl3 UTSW 6 34785284 missense probably damaging 0.97
R5354:Agbl3 UTSW 6 34814752 missense probably benign 0.03
R5386:Agbl3 UTSW 6 34799196 missense probably damaging 1.00
R5897:Agbl3 UTSW 6 34803573 missense probably benign 0.21
R6018:Agbl3 UTSW 6 34799255 missense probably damaging 1.00
R6148:Agbl3 UTSW 6 34857753 missense possibly damaging 0.87
R6305:Agbl3 UTSW 6 34782210 missense unknown
R6525:Agbl3 UTSW 6 34803594 nonsense probably null
R6546:Agbl3 UTSW 6 34799299 missense probably damaging 1.00
R6986:Agbl3 UTSW 6 34839452 missense probably benign 0.42
R7023:Agbl3 UTSW 6 34814769 missense probably benign 0.02
R7411:Agbl3 UTSW 6 34814819 missense probably damaging 0.99
R7469:Agbl3 UTSW 6 34814414 missense probably damaging 1.00
R7631:Agbl3 UTSW 6 34857671 missense possibly damaging 0.95
R7658:Agbl3 UTSW 6 34832508 missense probably benign 0.11
R7743:Agbl3 UTSW 6 34846830 missense probably damaging 1.00
R7801:Agbl3 UTSW 6 34839365 missense probably benign 0.00
RF014:Agbl3 UTSW 6 34799358 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGTTGCTCCCTAGAGTCACATC -3'
(R):5'- TAATGACCTAACAAGCCGTGCTTC -3'

Sequencing Primer
(F):5'- TCCCTAGAGTCACATCACCAGTTG -3'
(R):5'- CAAGCCGTGCTTCCTTATAAAACTG -3'
Posted On2018-08-29