Incidental Mutation 'R6743:Etnk1'
ID532736
Institutional Source Beutler Lab
Gene Symbol Etnk1
Ensembl Gene ENSMUSG00000030275
Gene Nameethanolamine kinase 1
SynonymsEKI1, D6Ertd3e, 4930555L11Rik, 1110061E11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6743 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location143167221-143232307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143180617 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 63 (I63V)
Ref Sequence ENSEMBL: ENSMUSP00000144903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032413] [ENSMUST00000204947] [ENSMUST00000205256]
Predicted Effect probably benign
Transcript: ENSMUST00000032413
AA Change: I63V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032413
Gene: ENSMUSG00000030275
AA Change: I63V

DomainStartEndE-ValueType
Pfam:APH 50 296 1.8e-16 PFAM
Pfam:Choline_kinase 71 276 2.8e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204947
AA Change: I63V

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145041
Gene: ENSMUSG00000030275
AA Change: I63V

DomainStartEndE-ValueType
Pfam:APH 50 296 2.3e-14 PFAM
Pfam:Choline_kinase 71 276 2.7e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205256
AA Change: I63V

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144903
Gene: ENSMUSG00000030275
AA Change: I63V

DomainStartEndE-ValueType
Pfam:APH 50 296 1.7e-14 PFAM
Pfam:Choline_kinase 71 276 2.1e-61 PFAM
Pfam:EcKinase 184 260 3e-4 PFAM
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ethanolamine kinase, which functions in the first committed step of the phosphatidylethanolamine synthesis pathway. This cytosolic enzyme is specific for ethanolamine and exhibits negligible kinase activity on choline. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,108,347 R339C possibly damaging Het
Adamts6 G A 13: 104,428,928 G721R probably damaging Het
Adnp2 A G 18: 80,128,059 V1045A probably benign Het
Agbl3 T C 6: 34,846,953 I856T probably benign Het
Anapc1 T A 2: 128,684,534 K115* probably null Het
Arc A G 15: 74,671,787 S196P probably benign Het
Atp10a T C 7: 58,797,814 I768T possibly damaging Het
Blk C T 14: 63,384,926 R55H probably benign Het
Ccdc105 G A 10: 78,752,892 T28M probably benign Het
Ccdc158 T C 5: 92,662,146 S168G probably benign Het
Cda G T 4: 138,338,942 T128K probably benign Het
Celsr1 T A 15: 85,907,598 T2601S probably damaging Het
Dmxl1 T C 18: 49,880,780 V1545A possibly damaging Het
Dst T A 1: 34,270,890 N6264K probably damaging Het
Ednra T C 8: 77,675,089 S191G probably damaging Het
Elk3 A T 10: 93,265,050 S280T possibly damaging Het
Fscb A G 12: 64,471,573 S1040P unknown Het
Gm14295 T G 2: 176,810,627 C637G probably damaging Het
Gm5114 T C 7: 39,408,573 T541A probably benign Het
Man2c1 T C 9: 57,135,565 F240L probably benign Het
Map2 A T 1: 66,415,607 I1219L probably benign Het
Map3k13 A G 16: 21,892,423 Y152C probably damaging Het
Mettl7a3 A G 15: 100,335,242 K105E probably benign Het
Morc1 G A 16: 48,502,320 A327T probably damaging Het
Myo3a A T 2: 22,361,664 Y553F probably benign Het
Myo9b T A 8: 71,352,159 probably null Het
Olfr125 A C 17: 37,835,803 D268A probably damaging Het
Olfr1469 C T 19: 13,410,593 T8I probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pde6a T A 18: 61,263,986 F634L possibly damaging Het
Pkd1l2 C A 8: 117,030,631 C1556F probably damaging Het
Prdm5 G A 6: 65,883,651 V440I probably damaging Het
Rasa2 T C 9: 96,611,440 T64A probably damaging Het
Sec24b A T 3: 130,041,232 Y106N probably damaging Het
Sfswap C T 5: 129,550,819 Q689* probably null Het
Slamf8 C T 1: 172,590,398 probably null Het
Tsr1 T C 11: 74,908,351 V786A probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zmynd10 T C 9: 107,547,880 I58T possibly damaging Het
Other mutations in Etnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Etnk1 APN 6 143180666 missense probably damaging 1.00
R0415:Etnk1 UTSW 6 143180774 missense probably damaging 1.00
R0928:Etnk1 UTSW 6 143184703 missense probably benign 0.00
R1542:Etnk1 UTSW 6 143180641 missense probably benign 0.00
R4648:Etnk1 UTSW 6 143195274 missense probably damaging 1.00
R4744:Etnk1 UTSW 6 143186593 missense probably damaging 1.00
R4823:Etnk1 UTSW 6 143167638 critical splice donor site probably null
R5039:Etnk1 UTSW 6 143195317 critical splice donor site probably null
R5909:Etnk1 UTSW 6 143197438 missense probably benign 0.02
R6207:Etnk1 UTSW 6 143180798 missense probably damaging 0.99
R7009:Etnk1 UTSW 6 143203154 critical splice donor site probably null
X0026:Etnk1 UTSW 6 143180726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTGGTGGATACTAACTGTGTAC -3'
(R):5'- TGAAAATGGCTGGGTTGCAG -3'

Sequencing Primer
(F):5'- CTCTAAACTATACCCAAACTTGTGG -3'
(R):5'- GCTTCGCCCTGGATAAACTCATAG -3'
Posted On2018-08-29