Incidental Mutation 'R6743:Ednra'
ID532740
Institutional Source Beutler Lab
Gene Symbol Ednra
Ensembl Gene ENSMUSG00000031616
Gene Nameendothelin receptor type A
SynonymsGpcr10, ET-AR, ETa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6743 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location77663031-77724464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77675089 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 191 (S191G)
Ref Sequence ENSEMBL: ENSMUSP00000034029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034029]
Predicted Effect probably damaging
Transcript: ENSMUST00000034029
AA Change: S191G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034029
Gene: ENSMUSG00000031616
AA Change: S191G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:7tm_1 97 370 8.4e-36 PFAM
low complexity region 376 394 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for endothelin-1, a peptide that plays a role in potent and long-lasting vasoconstriction. This receptor associates with guanine-nucleotide-binding (G) proteins, and this coupling activates a phosphatidylinositol-calcium second messenger system. Polymorphisms in this gene have been linked to migraine headache resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous inactivation of this gene results in numerous severe craniofacial defects and perinatal lethality. Aberrant middle ear development and cardiac defects, including great vessel malformations and abnormal cardiac outflow tract development, have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,108,347 R339C possibly damaging Het
Adamts6 G A 13: 104,428,928 G721R probably damaging Het
Adnp2 A G 18: 80,128,059 V1045A probably benign Het
Agbl3 T C 6: 34,846,953 I856T probably benign Het
Anapc1 T A 2: 128,684,534 K115* probably null Het
Arc A G 15: 74,671,787 S196P probably benign Het
Atp10a T C 7: 58,797,814 I768T possibly damaging Het
Blk C T 14: 63,384,926 R55H probably benign Het
Ccdc105 G A 10: 78,752,892 T28M probably benign Het
Ccdc158 T C 5: 92,662,146 S168G probably benign Het
Cda G T 4: 138,338,942 T128K probably benign Het
Celsr1 T A 15: 85,907,598 T2601S probably damaging Het
Dmxl1 T C 18: 49,880,780 V1545A possibly damaging Het
Dst T A 1: 34,270,890 N6264K probably damaging Het
Elk3 A T 10: 93,265,050 S280T possibly damaging Het
Etnk1 A G 6: 143,180,617 I63V possibly damaging Het
Fscb A G 12: 64,471,573 S1040P unknown Het
Gm14295 T G 2: 176,810,627 C637G probably damaging Het
Gm5114 T C 7: 39,408,573 T541A probably benign Het
Man2c1 T C 9: 57,135,565 F240L probably benign Het
Map2 A T 1: 66,415,607 I1219L probably benign Het
Map3k13 A G 16: 21,892,423 Y152C probably damaging Het
Mettl7a3 A G 15: 100,335,242 K105E probably benign Het
Morc1 G A 16: 48,502,320 A327T probably damaging Het
Myo3a A T 2: 22,361,664 Y553F probably benign Het
Myo9b T A 8: 71,352,159 probably null Het
Olfr125 A C 17: 37,835,803 D268A probably damaging Het
Olfr1469 C T 19: 13,410,593 T8I probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pde6a T A 18: 61,263,986 F634L possibly damaging Het
Pkd1l2 C A 8: 117,030,631 C1556F probably damaging Het
Prdm5 G A 6: 65,883,651 V440I probably damaging Het
Rasa2 T C 9: 96,611,440 T64A probably damaging Het
Sec24b A T 3: 130,041,232 Y106N probably damaging Het
Sfswap C T 5: 129,550,819 Q689* probably null Het
Slamf8 C T 1: 172,590,398 probably null Het
Tsr1 T C 11: 74,908,351 V786A probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zmynd10 T C 9: 107,547,880 I58T possibly damaging Het
Other mutations in Ednra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ednra APN 8 77675071 missense probably damaging 1.00
IGL02943:Ednra APN 8 77720054 missense probably damaging 1.00
IGL03213:Ednra APN 8 77720219 missense probably benign
Starved UTSW 8 77675067 missense possibly damaging 0.82
R0058:Ednra UTSW 8 77667322 critical splice donor site probably null
R0080:Ednra UTSW 8 77675059 missense probably benign
R0894:Ednra UTSW 8 77720020 splice site probably benign
R1746:Ednra UTSW 8 77671582 missense probably benign 0.44
R1872:Ednra UTSW 8 77720396 missense possibly damaging 0.46
R1934:Ednra UTSW 8 77689118 missense possibly damaging 0.55
R3776:Ednra UTSW 8 77675095 missense probably damaging 1.00
R4177:Ednra UTSW 8 77675048 missense possibly damaging 0.54
R4274:Ednra UTSW 8 77720302 missense probably benign 0.01
R4544:Ednra UTSW 8 77674911 critical splice donor site probably null
R4697:Ednra UTSW 8 77664995 missense probably benign 0.01
R4704:Ednra UTSW 8 77667963 intron probably benign
R4863:Ednra UTSW 8 77667383 missense probably damaging 1.00
R5265:Ednra UTSW 8 77667375 missense probably damaging 1.00
R5346:Ednra UTSW 8 77674968 missense probably damaging 1.00
R5772:Ednra UTSW 8 77675067 missense possibly damaging 0.82
R6005:Ednra UTSW 8 77674927 missense possibly damaging 0.91
R6147:Ednra UTSW 8 77667322 critical splice donor site probably benign
R6384:Ednra UTSW 8 77689094 missense probably damaging 1.00
R7084:Ednra UTSW 8 77665105 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCTCCATGAACTTGGACGTG -3'
(R):5'- CCAAATGGGAAGTTGGTTTGC -3'

Sequencing Primer
(F):5'- CATGAACTTGGACGTGGCGTTG -3'
(R):5'- TCAAGGCTGGCTGAAAATTCCTC -3'
Posted On2018-08-29