Mutagenetix > Incidental Mutations

Incidental Mutation 'R6743:Rasa2'

532744

Institutional Source

Beutler Lab

Gene Symbol

Rasa2

Ensembl Gene

ENSMUSG00000032413

Gene Name

RAS p21 protein activator 2

Synonyms

GAP1m, 5430433H21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.151) question?

Stock #

R6743 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

96539300-96631617 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96611440 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 64 (T64A)

Ref Sequence

ENSEMBL: ENSMUSP00000034984 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034984] [ENSMUST00000128346]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034984
AA Change: T64A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034984
Gene: ENSMUSG00000032413
AA Change: T64A

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
C2	38	136	3.78e-16	SMART
C2	171	287	8.48e-19	SMART
RasGAP	300	641	7.05e-140	SMART
PH	604	706	1.98e-17	SMART
BTK	706	742	1.39e-18	SMART
low complexity region	824	838	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000128346

SMART Domains

Protein: ENSMUSP00000115629
Gene: ENSMUSG00000032413

Domain	Start	End	E-Value	Type
C2	3	79	6.86e-5	SMART
C2	114	230	8.48e-19	SMART
RasGAP	243	584	7.05e-140	SMART

Meta Mutation Damage Score

0.1578

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg1	C	T	17: 31,108,347	R339C	possibly damaging	Het
Adamts6	G	A	13: 104,428,928	G721R	probably damaging	Het
Adnp2	A	G	18: 80,128,059	V1045A	probably benign	Het
Agbl3	T	C	6: 34,846,953	I856T	probably benign	Het
Anapc1	T	A	2: 128,684,534	K115*	probably null	Het
Arc	A	G	15: 74,671,787	S196P	probably benign	Het
Atp10a	T	C	7: 58,797,814	I768T	possibly damaging	Het
Blk	C	T	14: 63,384,926	R55H	probably benign	Het
Ccdc105	G	A	10: 78,752,892	T28M	probably benign	Het
Ccdc158	T	C	5: 92,662,146	S168G	probably benign	Het
Cda	G	T	4: 138,338,942	T128K	probably benign	Het
Celsr1	T	A	15: 85,907,598	T2601S	probably damaging	Het
Dmxl1	T	C	18: 49,880,780	V1545A	possibly damaging	Het
Dst	T	A	1: 34,270,890	N6264K	probably damaging	Het
Ednra	T	C	8: 77,675,089	S191G	probably damaging	Het
Elk3	A	T	10: 93,265,050	S280T	possibly damaging	Het
Etnk1	A	G	6: 143,180,617	I63V	possibly damaging	Het
Fscb	A	G	12: 64,471,573	S1040P	unknown	Het
Gm14295	T	G	2: 176,810,627	C637G	probably damaging	Het
Gm5114	T	C	7: 39,408,573	T541A	probably benign	Het
Man2c1	T	C	9: 57,135,565	F240L	probably benign	Het
Map2	A	T	1: 66,415,607	I1219L	probably benign	Het
Map3k13	A	G	16: 21,892,423	Y152C	probably damaging	Het
Mettl7a3	A	G	15: 100,335,242	K105E	probably benign	Het
Morc1	G	A	16: 48,502,320	A327T	probably damaging	Het
Myo3a	A	T	2: 22,361,664	Y553F	probably benign	Het
Myo9b	T	A	8: 71,352,159		probably null	Het
Olfr125	A	C	17: 37,835,803	D268A	probably damaging	Het
Olfr1469	C	T	19: 13,410,593	T8I	probably damaging	Het
Pam	A	G	1: 97,896,049	V219A	probably benign	Het
Panx1	A	G	9: 15,007,633	I310T	possibly damaging	Het
Pde6a	T	A	18: 61,263,986	F634L	possibly damaging	Het
Pkd1l2	C	A	8: 117,030,631	C1556F	probably damaging	Het
Prdm5	G	A	6: 65,883,651	V440I	probably damaging	Het
Sec24b	A	T	3: 130,041,232	Y106N	probably damaging	Het
Sfswap	C	T	5: 129,550,819	Q689*	probably null	Het
Slamf8	C	T	1: 172,590,398		probably null	Het
Tsr1	T	C	11: 74,908,351	V786A	probably benign	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zmynd10	T	C	9: 107,547,880	I58T	possibly damaging	Het

Other mutations in Rasa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Rasa2	APN	9	96544860	missense	probably damaging	1.00
IGL00661:Rasa2	APN	9	96577553	splice site	probably benign
IGL00825:Rasa2	APN	9	96570719	missense	probably benign	0.37
IGL01645:Rasa2	APN	9	96582781	nonsense	probably null
IGL02260:Rasa2	APN	9	96544319	missense	probably benign	0.08
IGL02568:Rasa2	APN	9	96580510	missense	probably damaging	1.00
IGL02963:Rasa2	APN	9	96570785	missense	probably damaging	1.00
R0018:Rasa2	UTSW	9	96571963	missense	probably damaging	1.00
R0018:Rasa2	UTSW	9	96571963	missense	probably damaging	1.00
R0144:Rasa2	UTSW	9	96592019	missense	probably damaging	0.99
R0238:Rasa2	UTSW	9	96568407	missense	probably damaging	1.00
R0238:Rasa2	UTSW	9	96568407	missense	probably damaging	1.00
R0295:Rasa2	UTSW	9	96545810	splice site	probably null
R0332:Rasa2	UTSW	9	96606176	missense	probably damaging	1.00
R0348:Rasa2	UTSW	9	96571959	missense	probably damaging	1.00
R0931:Rasa2	UTSW	9	96552404	missense	possibly damaging	0.88
R1067:Rasa2	UTSW	9	96552323	missense	probably damaging	1.00
R1485:Rasa2	UTSW	9	96544348	missense	probably benign	0.00
R1562:Rasa2	UTSW	9	96545750	missense	possibly damaging	0.89
R1698:Rasa2	UTSW	9	96568375	missense	possibly damaging	0.56
R1980:Rasa2	UTSW	9	96570768	missense	probably damaging	0.99
R3055:Rasa2	UTSW	9	96611473	missense	possibly damaging	0.77
R4175:Rasa2	UTSW	9	96560777	missense	probably benign	0.01
R4258:Rasa2	UTSW	9	96557380	intron	probably benign
R4432:Rasa2	UTSW	9	96542407	unclassified	probably benign
R4636:Rasa2	UTSW	9	96544337	missense	probably benign
R4773:Rasa2	UTSW	9	96544417	missense	probably benign
R4990:Rasa2	UTSW	9	96591989	missense	probably benign	0.24
R5177:Rasa2	UTSW	9	96544791	nonsense	probably null
R5462:Rasa2	UTSW	9	96571918	missense	probably damaging	1.00
R5737:Rasa2	UTSW	9	96570665	critical splice donor site	probably null
R5775:Rasa2	UTSW	9	96577468	splice site	probably null
R5866:Rasa2	UTSW	9	96545770	missense	probably benign	0.00
R5938:Rasa2	UTSW	9	96611389	missense	possibly damaging	0.50
R6076:Rasa2	UTSW	9	96545646	missense	probably benign
R6216:Rasa2	UTSW	9	96544304	missense	probably damaging	1.00
R6982:Rasa2	UTSW	9	96560750	missense	probably damaging	1.00
R7350:Rasa2	UTSW	9	96544355	missense	probably benign	0.16
R7405:Rasa2	UTSW	9	96566027	missense	probably benign	0.09
R7421:Rasa2	UTSW	9	96611447	missense	unknown
R7490:Rasa2	UTSW	9	96566122	missense	possibly damaging	0.48
R7515:Rasa2	UTSW	9	96552300	splice site	probably null
R7547:Rasa2	UTSW	9	96611421	missense	probably damaging	1.00
R7557:Rasa2	UTSW	9	96557425	missense	probably damaging	0.98
R7821:Rasa2	UTSW	9	96580484	splice site	probably null
R7894:Rasa2	UTSW	9	96602727	missense	probably benign	0.13
R8089:Rasa2	UTSW	9	96553124	missense	probably benign	0.00
R8193:Rasa2	UTSW	9	96602738	missense	probably damaging	0.97
RF017:Rasa2	UTSW	9	96631468	small insertion	probably benign
RF029:Rasa2	UTSW	9	96631467	small insertion	probably benign
RF047:Rasa2	UTSW	9	96631467	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTGGGGTCACTCTTAGAGAC -3'
(R):5'- GACCTCTCTGAGCACAAGTTG -3'

Sequencing Primer
(F):5'- CAGCCTACTTAGGAGGTGTGAACTTC -3'
(R):5'- GCCTTCTTCCAGACTGAA -3'

Posted On

2018-08-29