Incidental Mutation 'R6743:Arc'
ID532752
Institutional Source Beutler Lab
Gene Symbol Arc
Ensembl Gene ENSMUSG00000022602
Gene Nameactivity regulated cytoskeletal-associated protein
SynonymsArc3.1, arg 3.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6743 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location74669083-74672570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74671787 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 196 (S196P)
Ref Sequence ENSEMBL: ENSMUSP00000105636 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000023268
AA Change: S196P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000110009
AA Change: S196P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Homozygous deletion of this gene results in embryonic lethality around E6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,108,347 R339C possibly damaging Het
Adamts6 G A 13: 104,428,928 G721R probably damaging Het
Adnp2 A G 18: 80,128,059 V1045A probably benign Het
Agbl3 T C 6: 34,846,953 I856T probably benign Het
Anapc1 T A 2: 128,684,534 K115* probably null Het
Atp10a T C 7: 58,797,814 I768T possibly damaging Het
Blk C T 14: 63,384,926 R55H probably benign Het
Ccdc105 G A 10: 78,752,892 T28M probably benign Het
Ccdc158 T C 5: 92,662,146 S168G probably benign Het
Cda G T 4: 138,338,942 T128K probably benign Het
Celsr1 T A 15: 85,907,598 T2601S probably damaging Het
Dmxl1 T C 18: 49,880,780 V1545A possibly damaging Het
Dst T A 1: 34,270,890 N6264K probably damaging Het
Ednra T C 8: 77,675,089 S191G probably damaging Het
Elk3 A T 10: 93,265,050 S280T possibly damaging Het
Etnk1 A G 6: 143,180,617 I63V possibly damaging Het
Fscb A G 12: 64,471,573 S1040P unknown Het
Gm14295 T G 2: 176,810,627 C637G probably damaging Het
Gm5114 T C 7: 39,408,573 T541A probably benign Het
Man2c1 T C 9: 57,135,565 F240L probably benign Het
Map2 A T 1: 66,415,607 I1219L probably benign Het
Map3k13 A G 16: 21,892,423 Y152C probably damaging Het
Mettl7a3 A G 15: 100,335,242 K105E probably benign Het
Morc1 G A 16: 48,502,320 A327T probably damaging Het
Myo3a A T 2: 22,361,664 Y553F probably benign Het
Myo9b T A 8: 71,352,159 probably null Het
Olfr125 A C 17: 37,835,803 D268A probably damaging Het
Olfr1469 C T 19: 13,410,593 T8I probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pde6a T A 18: 61,263,986 F634L possibly damaging Het
Pkd1l2 C A 8: 117,030,631 C1556F probably damaging Het
Prdm5 G A 6: 65,883,651 V440I probably damaging Het
Rasa2 T C 9: 96,611,440 T64A probably damaging Het
Sec24b A T 3: 130,041,232 Y106N probably damaging Het
Sfswap C T 5: 129,550,819 Q689* probably null Het
Slamf8 C T 1: 172,590,398 probably null Het
Tsr1 T C 11: 74,908,351 V786A probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zmynd10 T C 9: 107,547,880 I58T possibly damaging Het
Other mutations in Arc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Arc APN 15 74672355 missense probably benign
IGL02372:Arc APN 15 74672105 missense probably damaging 1.00
IGL03209:Arc APN 15 74671984 missense probably damaging 1.00
P0040:Arc UTSW 15 74671339 missense probably damaging 1.00
R0732:Arc UTSW 15 74671195 missense probably damaging 1.00
R1377:Arc UTSW 15 74672252 missense possibly damaging 0.51
R2430:Arc UTSW 15 74671891 missense probably benign 0.01
R4647:Arc UTSW 15 74671525 missense probably damaging 1.00
R4855:Arc UTSW 15 74671743 missense probably benign 0.01
R6436:Arc UTSW 15 74672249 missense possibly damaging 0.47
RF003:Arc UTSW 15 74672131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTGCAGAAACTCCTTCTTGAACTC -3'
(R):5'- AGTCCATGGGCGGCAAATAC -3'

Sequencing Primer
(F):5'- ACCGAGCCCTGCTTGAACTC -3'
(R):5'- GGCGGCAAATACCCAGTG -3'
Posted On2018-08-29