Incidental Mutation 'R6743:Morc1'
ID532756
Institutional Source Beutler Lab
Gene Symbol Morc1
Ensembl Gene ENSMUSG00000022652
Gene Namemicrorchidia 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R6743 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location48431237-48630900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48502320 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 327 (A327T)
Ref Sequence ENSEMBL: ENSMUSP00000023330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023330]
Predicted Effect probably damaging
Transcript: ENSMUST00000023330
AA Change: A327T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023330
Gene: ENSMUSG00000022652
AA Change: A327T

DomainStartEndE-ValueType
Pfam:HATPase_c_3 24 161 3.8e-21 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 281 311 N/A INTRINSIC
Pfam:zf-CW 481 528 2e-14 PFAM
low complexity region 639 651 N/A INTRINSIC
coiled coil region 885 916 N/A INTRINSIC
Meta Mutation Damage Score 0.1182 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of mouse morc and like the mouse protein it is testis-specific. Mouse studies support a testis-specific function since only male knockout mice are infertile; infertility is the only apparent defect. These studies further support a role for this protein early in spermatogenesis, possibly by affecting entry into apoptosis because testis from knockout mice show greatly increased numbers of apoptotic cells. [provided by RefSeq, Jan 2009]
PHENOTYPE: Inactivation of this locus results in small testes and male sterility, the latter owing to meiotic arrest. Mutant females exhibited histologically normal ovaries and were fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,108,347 R339C possibly damaging Het
Adamts6 G A 13: 104,428,928 G721R probably damaging Het
Adnp2 A G 18: 80,128,059 V1045A probably benign Het
Agbl3 T C 6: 34,846,953 I856T probably benign Het
Anapc1 T A 2: 128,684,534 K115* probably null Het
Arc A G 15: 74,671,787 S196P probably benign Het
Atp10a T C 7: 58,797,814 I768T possibly damaging Het
Blk C T 14: 63,384,926 R55H probably benign Het
Ccdc105 G A 10: 78,752,892 T28M probably benign Het
Ccdc158 T C 5: 92,662,146 S168G probably benign Het
Cda G T 4: 138,338,942 T128K probably benign Het
Celsr1 T A 15: 85,907,598 T2601S probably damaging Het
Dmxl1 T C 18: 49,880,780 V1545A possibly damaging Het
Dst T A 1: 34,270,890 N6264K probably damaging Het
Ednra T C 8: 77,675,089 S191G probably damaging Het
Elk3 A T 10: 93,265,050 S280T possibly damaging Het
Etnk1 A G 6: 143,180,617 I63V possibly damaging Het
Fscb A G 12: 64,471,573 S1040P unknown Het
Gm14295 T G 2: 176,810,627 C637G probably damaging Het
Gm5114 T C 7: 39,408,573 T541A probably benign Het
Man2c1 T C 9: 57,135,565 F240L probably benign Het
Map2 A T 1: 66,415,607 I1219L probably benign Het
Map3k13 A G 16: 21,892,423 Y152C probably damaging Het
Mettl7a3 A G 15: 100,335,242 K105E probably benign Het
Myo3a A T 2: 22,361,664 Y553F probably benign Het
Myo9b T A 8: 71,352,159 probably null Het
Olfr125 A C 17: 37,835,803 D268A probably damaging Het
Olfr1469 C T 19: 13,410,593 T8I probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pde6a T A 18: 61,263,986 F634L possibly damaging Het
Pkd1l2 C A 8: 117,030,631 C1556F probably damaging Het
Prdm5 G A 6: 65,883,651 V440I probably damaging Het
Rasa2 T C 9: 96,611,440 T64A probably damaging Het
Sec24b A T 3: 130,041,232 Y106N probably damaging Het
Sfswap C T 5: 129,550,819 Q689* probably null Het
Slamf8 C T 1: 172,590,398 probably null Het
Tsr1 T C 11: 74,908,351 V786A probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zmynd10 T C 9: 107,547,880 I58T possibly damaging Het
Other mutations in Morc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Morc1 APN 16 48612326 missense probably damaging 0.98
IGL00815:Morc1 APN 16 48460692 missense possibly damaging 0.62
IGL00939:Morc1 APN 16 48452589 missense probably damaging 0.99
IGL01321:Morc1 APN 16 48582462 missense probably benign 0.00
IGL01410:Morc1 APN 16 48612314 missense probably benign 0.16
IGL01557:Morc1 APN 16 48498766 missense probably damaging 1.00
IGL02118:Morc1 APN 16 48587104 missense probably benign 0.01
IGL02626:Morc1 APN 16 48615760 missense probably damaging 0.96
IGL02692:Morc1 APN 16 48510233 missense probably null 0.95
IGL02812:Morc1 APN 16 48558506 splice site probably benign
IGL03232:Morc1 APN 16 48630802 missense probably benign 0.06
IGL03331:Morc1 APN 16 48612368 splice site probably benign
IGL03408:Morc1 APN 16 48442412 missense probably damaging 1.00
R0545:Morc1 UTSW 16 48565657 missense probably benign 0.05
R0569:Morc1 UTSW 16 48587122 missense probably benign 0.02
R0699:Morc1 UTSW 16 48592614 missense probably benign 0.01
R1717:Morc1 UTSW 16 48452477 missense probably benign 0.01
R1728:Morc1 UTSW 16 48612297 missense probably benign 0.10
R1803:Morc1 UTSW 16 48622638 missense probably benign 0.14
R1864:Morc1 UTSW 16 48592530 missense probably benign 0.01
R2008:Morc1 UTSW 16 48565646 missense probably benign 0.41
R2070:Morc1 UTSW 16 48592611 missense probably benign 0.00
R2071:Morc1 UTSW 16 48592611 missense probably benign 0.00
R4851:Morc1 UTSW 16 48561617 missense probably benign 0.02
R5013:Morc1 UTSW 16 48502336 missense probably benign 0.11
R5081:Morc1 UTSW 16 48502352 missense probably benign 0.01
R5259:Morc1 UTSW 16 48630769 missense probably benign 0.12
R5342:Morc1 UTSW 16 48618509 missense probably damaging 0.99
R5481:Morc1 UTSW 16 48561485 intron probably null
R5561:Morc1 UTSW 16 48449348 missense probably benign 0.43
R6356:Morc1 UTSW 16 48437289 missense probably damaging 1.00
R6526:Morc1 UTSW 16 48587124 nonsense probably null
R6940:Morc1 UTSW 16 48479845 nonsense probably null
R6994:Morc1 UTSW 16 48565621 missense probably benign 0.00
R6994:Morc1 UTSW 16 48618546 missense probably benign 0.39
R7009:Morc1 UTSW 16 48627070 missense possibly damaging 0.69
R7346:Morc1 UTSW 16 48630900 splice site probably null
R7357:Morc1 UTSW 16 48622590 missense probably benign 0.14
R7448:Morc1 UTSW 16 48431345 missense probably damaging 0.97
R7840:Morc1 UTSW 16 48498784 missense probably benign 0.03
R7923:Morc1 UTSW 16 48498784 missense probably benign 0.03
X0013:Morc1 UTSW 16 48587068 missense probably benign 0.04
X0027:Morc1 UTSW 16 48498811 missense probably damaging 1.00
Z1176:Morc1 UTSW 16 48587058 missense probably benign 0.03
Z1177:Morc1 UTSW 16 48565706 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AACACTGGGATGAAGCCTATTGC -3'
(R):5'- TTAGTTGGGGAAGCCTCATCAC -3'

Sequencing Primer
(F):5'- GCCTATTGCTGTGTGCCTG -3'
(R):5'- TTGGGGAAGCCTCATCACATTAAG -3'
Posted On2018-08-29