Incidental Mutation 'R6743:Olfr125'
ID532758
Institutional Source Beutler Lab
Gene Symbol Olfr125
Ensembl Gene ENSMUSG00000050613
Gene Nameolfactory receptor 125
SynonymsGA_x6K02T2PSCP-2291580-2292542, MOR218-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6743 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37832949-37838490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 37835803 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 268 (D268A)
Ref Sequence ENSEMBL: ENSMUSP00000149602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050255] [ENSMUST00000213857]
Predicted Effect probably damaging
Transcript: ENSMUST00000050255
AA Change: D268A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055221
Gene: ENSMUSG00000050613
AA Change: D268A

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.7e-47 PFAM
Pfam:7tm_1 38 318 7.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213857
AA Change: D268A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,108,347 R339C possibly damaging Het
Adamts6 G A 13: 104,428,928 G721R probably damaging Het
Adnp2 A G 18: 80,128,059 V1045A probably benign Het
Agbl3 T C 6: 34,846,953 I856T probably benign Het
Anapc1 T A 2: 128,684,534 K115* probably null Het
Arc A G 15: 74,671,787 S196P probably benign Het
Atp10a T C 7: 58,797,814 I768T possibly damaging Het
Blk C T 14: 63,384,926 R55H probably benign Het
Ccdc105 G A 10: 78,752,892 T28M probably benign Het
Ccdc158 T C 5: 92,662,146 S168G probably benign Het
Cda G T 4: 138,338,942 T128K probably benign Het
Celsr1 T A 15: 85,907,598 T2601S probably damaging Het
Dmxl1 T C 18: 49,880,780 V1545A possibly damaging Het
Dst T A 1: 34,270,890 N6264K probably damaging Het
Ednra T C 8: 77,675,089 S191G probably damaging Het
Elk3 A T 10: 93,265,050 S280T possibly damaging Het
Etnk1 A G 6: 143,180,617 I63V possibly damaging Het
Fscb A G 12: 64,471,573 S1040P unknown Het
Gm14295 T G 2: 176,810,627 C637G probably damaging Het
Gm5114 T C 7: 39,408,573 T541A probably benign Het
Man2c1 T C 9: 57,135,565 F240L probably benign Het
Map2 A T 1: 66,415,607 I1219L probably benign Het
Map3k13 A G 16: 21,892,423 Y152C probably damaging Het
Mettl7a3 A G 15: 100,335,242 K105E probably benign Het
Morc1 G A 16: 48,502,320 A327T probably damaging Het
Myo3a A T 2: 22,361,664 Y553F probably benign Het
Myo9b T A 8: 71,352,159 probably null Het
Olfr1469 C T 19: 13,410,593 T8I probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pde6a T A 18: 61,263,986 F634L possibly damaging Het
Pkd1l2 C A 8: 117,030,631 C1556F probably damaging Het
Prdm5 G A 6: 65,883,651 V440I probably damaging Het
Rasa2 T C 9: 96,611,440 T64A probably damaging Het
Sec24b A T 3: 130,041,232 Y106N probably damaging Het
Sfswap C T 5: 129,550,819 Q689* probably null Het
Slamf8 C T 1: 172,590,398 probably null Het
Tsr1 T C 11: 74,908,351 V786A probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zmynd10 T C 9: 107,547,880 I58T possibly damaging Het
Other mutations in Olfr125
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Olfr125 APN 17 37835053 missense probably benign
IGL02103:Olfr125 APN 17 37835278 missense possibly damaging 0.91
IGL02121:Olfr125 APN 17 37835941 missense probably benign 0.01
IGL02183:Olfr125 APN 17 37835413 missense probably damaging 1.00
IGL02208:Olfr125 APN 17 37835524 missense probably damaging 1.00
IGL02822:Olfr125 APN 17 37835643 missense possibly damaging 0.95
IGL02833:Olfr125 APN 17 37835940 missense probably benign 0.02
IGL03324:Olfr125 APN 17 37835274 missense probably benign 0.23
R1689:Olfr125 UTSW 17 37835604 missense possibly damaging 0.88
R1719:Olfr125 UTSW 17 37835353 missense possibly damaging 0.76
R1878:Olfr125 UTSW 17 37835362 missense probably benign 0.03
R2064:Olfr125 UTSW 17 37835002 start codon destroyed probably null 0.06
R2696:Olfr125 UTSW 17 37835107 missense probably benign 0.00
R3800:Olfr125 UTSW 17 37835957 missense probably benign
R4469:Olfr125 UTSW 17 37835716 missense probably benign 0.35
R4801:Olfr125 UTSW 17 37835349 missense probably damaging 1.00
R4802:Olfr125 UTSW 17 37835349 missense probably damaging 1.00
R5473:Olfr125 UTSW 17 37835739 missense probably benign 0.04
R7481:Olfr125 UTSW 17 37835398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCATTTACAACATCCACAG -3'
(R):5'- AGCAATGCCTCTTAGTTTGTTG -3'

Sequencing Primer
(F):5'- GCATTTACAACATCCACAGCCTTTG -3'
(R):5'- CCTCTTAGTTTGTTGTCTCTTTAGAG -3'
Posted On2018-08-29