Incidental Mutation 'R6744:Cxxc4'
ID532769
Institutional Source Beutler Lab
Gene Symbol Cxxc4
Ensembl Gene ENSMUSG00000044365
Gene NameCXXC finger 4
Synonyms9330210J02Rik, C030003J12Rik, Idax
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6744 (G1)
Quality Score146.467
Status Not validated
Chromosome3
Chromosomal Location134236484-134262161 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) AGGCGGCGGCGGCGGCGGCGGCGGC to AGGCGGCGGCGGCGGCGGCGGCGGCGGC at 134240130 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166288] [ENSMUST00000181904]
Predicted Effect probably benign
Transcript: ENSMUST00000166288
SMART Domains Protein: ENSMUSP00000128574
Gene: ENSMUSG00000044365

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
Pfam:zf-CXXC 131 172 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181904
SMART Domains Protein: ENSMUSP00000138000
Gene: ENSMUSG00000044365

DomainStartEndE-ValueType
low complexity region 94 101 N/A INTRINSIC
low complexity region 105 165 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Pfam:zf-CXXC 299 340 5.8e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CXXC-type zinc finger domain-containing protein that functions as an antagonist of the canonical wingless/integrated signaling pathway. The encoded protein negatively regulates wingless/integrated signaling through interaction with the post synaptic density protein/ Drosophila disc large tumor suppressor/ zonula occludens-1 protein domain of Dishevelled, a scaffolding protein required for the stabilization of the transcriptional co-activator beta-catenin. In addition, the CXXC domain of this protein has been shown to bind unmethylated CpG dinucleotides, localize to promoters and CpG islands, and interact with the catalytic domain of methylcytosine dioxygenase ten-eleven-translocation 2, an iron and alpha-ketoglutarate-dependent dioxygenase that modifies the methylation status of DNA. In humans, a mutation in this gene has been associated with development of malignant renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T A 10: 20,965,567 L251H probably damaging Het
Alk A T 17: 72,603,082 S210T probably benign Het
Arap2 A G 5: 62,748,938 F246S probably damaging Het
Atad5 T A 11: 80,134,032 N1749K probably benign Het
C130060K24Rik T A 6: 65,441,340 M164K possibly damaging Het
C87436 T A 6: 86,446,064 S207T probably damaging Het
C8b C T 4: 104,774,346 R53W probably damaging Het
Catsperg2 A G 7: 29,709,819 V619A probably benign Het
Cdc73 G A 1: 143,702,149 probably benign Het
Cdh4 C A 2: 179,847,387 H297Q possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Crybg2 A G 4: 134,088,896 N1328S probably damaging Het
Ctnnb1 T A 9: 120,952,959 V346E probably damaging Het
Ctns C T 11: 73,185,285 G308E probably damaging Het
Dnah6 A G 6: 73,037,549 I3685T probably damaging Het
Dock6 T C 9: 21,831,474 H775R probably damaging Het
Fbxl3 A T 14: 103,083,294 V239D probably damaging Het
Gh T A 11: 106,301,404 K55* probably null Het
Gm49333 A T 16: 20,630,366 K165N probably damaging Het
Havcr2 T G 11: 46,455,060 probably null Het
Kcnq2 T A 2: 181,085,306 H576L possibly damaging Het
Kifap3 A G 1: 163,848,670 N398S probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Mblac1 A G 5: 138,194,420 E8G possibly damaging Het
Mtor C T 4: 148,458,655 T290I probably benign Het
Nceh1 T C 3: 27,241,789 Y400H probably damaging Het
Nek9 A G 12: 85,329,929 V226A probably benign Het
Olfr119 T A 17: 37,701,445 Y258* probably null Het
Olfr518 T C 7: 108,880,830 T259A probably damaging Het
Olfr710 A G 7: 106,944,534 S156P probably damaging Het
Otud4 C A 8: 79,673,778 Y1039* probably null Het
Pax4 T C 6: 28,442,397 H331R probably benign Het
Piezo2 A T 18: 63,032,889 Y2090* probably null Het
Ppp1r12a T A 10: 108,230,534 H195Q probably damaging Het
Ppp6r2 A G 15: 89,256,661 probably null Het
Prodh A G 16: 18,079,200 V23A probably benign Het
Psg20 G A 7: 18,674,580 T405I probably damaging Het
Ptprf T C 4: 118,236,365 D360G probably benign Het
Rad18 A T 6: 112,675,784 M284K probably damaging Het
Rgs17 T C 10: 5,842,567 K60E possibly damaging Het
Sec31a G T 5: 100,392,499 Q39K possibly damaging Het
Slc22a22 G T 15: 57,254,272 T291K possibly damaging Het
Sult2a6 C T 7: 14,222,545 E264K probably damaging Het
Syne2 C T 12: 76,074,447 R5896C probably damaging Het
Tctn1 A T 5: 122,264,146 V75D probably damaging Het
Tmem214 A G 5: 30,874,028 K409E probably damaging Het
Vcan T C 13: 89,705,182 Y553C probably damaging Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Other mutations in Cxxc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cxxc4 APN 3 134240659 missense probably null 0.99
R1839:Cxxc4 UTSW 3 134240653 missense probably damaging 1.00
R6265:Cxxc4 UTSW 3 134258063 missense probably benign 0.02
R6947:Cxxc4 UTSW 3 134240516 missense possibly damaging 0.90
R7764:Cxxc4 UTSW 3 134240095 missense unknown
R7842:Cxxc4 UTSW 3 134240332 missense possibly damaging 0.93
R7860:Cxxc4 UTSW 3 134258053 missense probably benign 0.21
Z1177:Cxxc4 UTSW 3 134240050 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTCTACAAGACCAACGGGG -3'
(R):5'- GAGCTTGTTCATGCATTCCC -3'

Sequencing Primer
(F):5'- ATGTCCCCGTGGAACTGC -3'
(R):5'- ATTCCCCCGCCAAAGGTCTG -3'
Posted On2018-08-29