Incidental Mutation 'R6744:C8b'
ID532770
Institutional Source Beutler Lab
Gene Symbol C8b
Ensembl Gene ENSMUSG00000029656
Gene Namecomplement component 8, beta polypeptide
Synonyms4930439B20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6744 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location104766317-104804548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104774346 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 53 (R53W)
Ref Sequence ENSEMBL: ENSMUSP00000066940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031663] [ENSMUST00000065072]
Predicted Effect probably damaging
Transcript: ENSMUST00000031663
AA Change: R53W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031663
Gene: ENSMUSG00000029656
AA Change: R53W

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 290 497 3.6e-65 SMART
Blast:EGF 501 534 9e-12 BLAST
TSP1 547 584 1.17e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065072
AA Change: R53W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066940
Gene: ENSMUSG00000029656
AA Change: R53W

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 224 431 3.6e-65 SMART
Blast:EGF 435 468 1e-11 BLAST
TSP1 481 518 1.17e-1 SMART
Meta Mutation Damage Score 0.1991 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the beta subunit, which associates with the alpha and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the alpha subunit. [provided by RefSeq, Oct 2015]
PHENOTYPE: In a controlled microbial environment ("clean") laboratory, mice homozygous for an inactivating mutation of this gene are viable and fertile and exhibit no apparent abonormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T A 10: 20,965,567 L251H probably damaging Het
Alk A T 17: 72,603,082 S210T probably benign Het
Arap2 A G 5: 62,748,938 F246S probably damaging Het
Atad5 T A 11: 80,134,032 N1749K probably benign Het
C130060K24Rik T A 6: 65,441,340 M164K possibly damaging Het
C87436 T A 6: 86,446,064 S207T probably damaging Het
Catsperg2 A G 7: 29,709,819 V619A probably benign Het
Cdc73 G A 1: 143,702,149 probably benign Het
Cdh4 C A 2: 179,847,387 H297Q possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Crybg2 A G 4: 134,088,896 N1328S probably damaging Het
Ctnnb1 T A 9: 120,952,959 V346E probably damaging Het
Ctns C T 11: 73,185,285 G308E probably damaging Het
Cxxc4 AGGCGGCGGCGGCGGCGGCGGCGGC AGGCGGCGGCGGCGGCGGCGGCGGCGGC 3: 134,240,130 probably benign Het
Dnah6 A G 6: 73,037,549 I3685T probably damaging Het
Dock6 T C 9: 21,831,474 H775R probably damaging Het
Fbxl3 A T 14: 103,083,294 V239D probably damaging Het
Gh T A 11: 106,301,404 K55* probably null Het
Gm49333 A T 16: 20,630,366 K165N probably damaging Het
Havcr2 T G 11: 46,455,060 probably null Het
Kcnq2 T A 2: 181,085,306 H576L possibly damaging Het
Kifap3 A G 1: 163,848,670 N398S probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Mblac1 A G 5: 138,194,420 E8G possibly damaging Het
Mtor C T 4: 148,458,655 T290I probably benign Het
Nceh1 T C 3: 27,241,789 Y400H probably damaging Het
Nek9 A G 12: 85,329,929 V226A probably benign Het
Olfr119 T A 17: 37,701,445 Y258* probably null Het
Olfr518 T C 7: 108,880,830 T259A probably damaging Het
Olfr710 A G 7: 106,944,534 S156P probably damaging Het
Otud4 C A 8: 79,673,778 Y1039* probably null Het
Pax4 T C 6: 28,442,397 H331R probably benign Het
Piezo2 A T 18: 63,032,889 Y2090* probably null Het
Ppp1r12a T A 10: 108,230,534 H195Q probably damaging Het
Ppp6r2 A G 15: 89,256,661 probably null Het
Prodh A G 16: 18,079,200 V23A probably benign Het
Psg20 G A 7: 18,674,580 T405I probably damaging Het
Ptprf T C 4: 118,236,365 D360G probably benign Het
Rad18 A T 6: 112,675,784 M284K probably damaging Het
Rgs17 T C 10: 5,842,567 K60E possibly damaging Het
Sec31a G T 5: 100,392,499 Q39K possibly damaging Het
Slc22a22 G T 15: 57,254,272 T291K possibly damaging Het
Sult2a6 C T 7: 14,222,545 E264K probably damaging Het
Syne2 C T 12: 76,074,447 R5896C probably damaging Het
Tctn1 A T 5: 122,264,146 V75D probably damaging Het
Tmem214 A G 5: 30,874,028 K409E probably damaging Het
Vcan T C 13: 89,705,182 Y553C probably damaging Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Other mutations in C8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:C8b APN 4 104801334 splice site probably benign
IGL01145:C8b APN 4 104780580 missense probably benign 0.25
IGL01768:C8b APN 4 104786954 missense probably benign 0.00
IGL02347:C8b APN 4 104786954 missense probably benign 0.00
IGL02488:C8b APN 4 104804081 missense probably benign
IGL02957:C8b APN 4 104766455 missense probably benign
IGL02979:C8b APN 4 104774388 missense probably damaging 0.99
IGL02995:C8b APN 4 104801328 splice site probably benign
IGL03294:C8b APN 4 104780691 missense probably benign 0.06
R0568:C8b UTSW 4 104793380 missense probably benign 0.39
R1015:C8b UTSW 4 104786960 missense probably benign 0.19
R1191:C8b UTSW 4 104793323 missense probably damaging 1.00
R1401:C8b UTSW 4 104784482 missense possibly damaging 0.72
R3824:C8b UTSW 4 104783009 missense probably benign 0.42
R4611:C8b UTSW 4 104790644 missense probably damaging 0.98
R4756:C8b UTSW 4 104786886 missense probably benign
R4845:C8b UTSW 4 104791812 missense possibly damaging 0.87
R5355:C8b UTSW 4 104780663 missense probably benign 0.01
R5436:C8b UTSW 4 104800349 nonsense probably null
R5561:C8b UTSW 4 104784448 missense possibly damaging 0.89
R5967:C8b UTSW 4 104793333 missense possibly damaging 0.79
R6899:C8b UTSW 4 104786874 missense probably benign 0.02
R6977:C8b UTSW 4 104786996 missense possibly damaging 0.82
R7088:C8b UTSW 4 104793343 missense probably benign 0.12
R7224:C8b UTSW 4 104780598 missense probably damaging 1.00
R7278:C8b UTSW 4 104780627 missense probably damaging 1.00
R8058:C8b UTSW 4 104790614 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAACAACTTCCTTGTGCTCCTG -3'
(R):5'- TACTGTCTGAAAGCACAGAGACAG -3'

Sequencing Primer
(F):5'- GCTCTGATCTACATTAATTTGATGGG -3'
(R):5'- ACAGTCTGCATCTTAAAGGGC -3'
Posted On2018-08-29