Incidental Mutation 'R6744:Ptprf'
ID 532771
Institutional Source Beutler Lab
Gene Symbol Ptprf
Ensembl Gene ENSMUSG00000033295
Gene Name protein tyrosine phosphatase receptor type F
Synonyms RPTP-LAR, LAR
MMRRC Submission 044861-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.657) question?
Stock # R6744 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118065410-118148602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118093562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 360 (D360G)
Ref Sequence ENSEMBL: ENSMUSP00000039368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049074] [ENSMUST00000222620]
AlphaFold A2A8L5
PDB Structure Tandem Ig domains of tyrosine phosphatase LAR [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049074
AA Change: D360G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: D360G

DomainStartEndE-ValueType
IGc2 45 114 2.64e-12 SMART
IGc2 147 214 1.48e-15 SMART
IG 238 316 1.06e-11 SMART
FN3 319 398 6.9e-14 SMART
FN3 414 497 5.73e-11 SMART
FN3 512 591 4.06e-11 SMART
FN3 606 693 8.69e-11 SMART
FN3 709 797 8.83e-12 SMART
FN3 812 892 3.2e-9 SMART
FN3 907 988 2.53e-12 SMART
FN3 1003 1079 3.48e-1 SMART
coiled coil region 1146 1175 N/A INTRINSIC
transmembrane domain 1253 1275 N/A INTRINSIC
PTPc 1342 1600 1.12e-138 SMART
PTPc 1629 1891 3.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124758
SMART Domains Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295

DomainStartEndE-ValueType
FN3 37 116 4.06e-11 SMART
FN3 132 220 8.83e-12 SMART
FN3 235 315 3.2e-9 SMART
FN3 330 411 2.53e-12 SMART
FN3 426 502 3.48e-1 SMART
coiled coil region 568 597 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
PTPc 776 1034 1.12e-138 SMART
PTPc 1063 1325 3.4e-129 SMART
Predicted Effect unknown
Transcript: ENSMUST00000150096
AA Change: D27G
SMART Domains Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: D27G

DomainStartEndE-ValueType
FN3 14 66 2.7e1 SMART
FN3 82 165 5.73e-11 SMART
FN3 180 259 4.06e-11 SMART
FN3 275 372 6.69e-12 SMART
FN3 385 461 2.83e-1 SMART
coiled coil region 527 556 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
PTPc 735 993 1.12e-138 SMART
PTPc 1022 1284 3.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222620
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T A 10: 20,841,466 (GRCm39) L251H probably damaging Het
Alk A T 17: 72,910,077 (GRCm39) S210T probably benign Het
Arap2 A G 5: 62,906,281 (GRCm39) F246S probably damaging Het
Atad5 T A 11: 80,024,858 (GRCm39) N1749K probably benign Het
C87436 T A 6: 86,423,046 (GRCm39) S207T probably damaging Het
C8b C T 4: 104,631,543 (GRCm39) R53W probably damaging Het
Catsperg2 A G 7: 29,409,244 (GRCm39) V619A probably benign Het
Cdc73 G A 1: 143,577,887 (GRCm39) probably benign Het
Cdh4 C A 2: 179,489,180 (GRCm39) H297Q possibly damaging Het
Col3a1 G T 1: 45,377,782 (GRCm39) probably benign Het
Crybg2 A G 4: 133,816,207 (GRCm39) N1328S probably damaging Het
Ctnnb1 T A 9: 120,782,025 (GRCm39) V346E probably damaging Het
Ctns C T 11: 73,076,111 (GRCm39) G308E probably damaging Het
Cxxc4 AGGCGGCGGCGGCGGCGGCGGCGGC AGGCGGCGGCGGCGGCGGCGGCGGCGGC 3: 133,945,891 (GRCm39) probably benign Het
Dnah6 A G 6: 73,014,532 (GRCm39) I3685T probably damaging Het
Dock6 T C 9: 21,742,770 (GRCm39) H775R probably damaging Het
Eef1ece2 A T 16: 20,449,116 (GRCm39) K165N probably damaging Het
Fbxl3 A T 14: 103,320,730 (GRCm39) V239D probably damaging Het
Gh T A 11: 106,192,230 (GRCm39) K55* probably null Het
Havcr2 T G 11: 46,345,887 (GRCm39) probably null Het
Kcnq2 T A 2: 180,727,099 (GRCm39) H576L possibly damaging Het
Kifap3 A G 1: 163,676,239 (GRCm39) N398S probably benign Het
Lama5 G A 2: 179,833,455 (GRCm39) P1519L probably damaging Het
Mblac1 A G 5: 138,192,682 (GRCm39) E8G possibly damaging Het
Mtor C T 4: 148,543,112 (GRCm39) T290I probably benign Het
Nceh1 T C 3: 27,295,938 (GRCm39) Y400H probably damaging Het
Nek9 A G 12: 85,376,703 (GRCm39) V226A probably benign Het
Or10a3 T C 7: 108,480,037 (GRCm39) T259A probably damaging Het
Or10al3 T A 17: 38,012,336 (GRCm39) Y258* probably null Het
Or2d4 A G 7: 106,543,741 (GRCm39) S156P probably damaging Het
Otud4 C A 8: 80,400,407 (GRCm39) Y1039* probably null Het
Pax4 T C 6: 28,442,396 (GRCm39) H331R probably benign Het
Piezo2 A T 18: 63,165,960 (GRCm39) Y2090* probably null Het
Ppp1r12a T A 10: 108,066,395 (GRCm39) H195Q probably damaging Het
Ppp6r2 A G 15: 89,140,864 (GRCm39) probably null Het
Prodh A G 16: 17,897,064 (GRCm39) V23A probably benign Het
Psg20 G A 7: 18,408,505 (GRCm39) T405I probably damaging Het
Qrfprl T A 6: 65,418,324 (GRCm39) M164K possibly damaging Het
Rad18 A T 6: 112,652,745 (GRCm39) M284K probably damaging Het
Rgs17 T C 10: 5,792,567 (GRCm39) K60E possibly damaging Het
Sec31a G T 5: 100,540,358 (GRCm39) Q39K possibly damaging Het
Slc22a22 G T 15: 57,117,668 (GRCm39) T291K possibly damaging Het
Sult2a6 C T 7: 13,956,470 (GRCm39) E264K probably damaging Het
Syne2 C T 12: 76,121,221 (GRCm39) R5896C probably damaging Het
Tctn1 A T 5: 122,402,209 (GRCm39) V75D probably damaging Het
Tmem214 A G 5: 31,031,372 (GRCm39) K409E probably damaging Het
Vcan T C 13: 89,853,301 (GRCm39) Y553C probably damaging Het
Vmn1r49 C T 6: 90,049,184 (GRCm39) V273I probably benign Het
Other mutations in Ptprf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ptprf APN 4 118,080,417 (GRCm39) splice site probably benign
IGL01337:Ptprf APN 4 118,093,488 (GRCm39) missense probably damaging 1.00
IGL01482:Ptprf APN 4 118,069,651 (GRCm39) missense probably damaging 1.00
IGL01743:Ptprf APN 4 118,106,095 (GRCm39) critical splice donor site probably null
IGL01987:Ptprf APN 4 118,134,567 (GRCm39) missense probably benign
IGL02189:Ptprf APN 4 118,070,839 (GRCm39) splice site probably benign
IGL03067:Ptprf APN 4 118,067,910 (GRCm39) missense possibly damaging 0.67
PIT4677001:Ptprf UTSW 4 118,070,809 (GRCm39) missense probably damaging 1.00
R0382:Ptprf UTSW 4 118,080,591 (GRCm39) splice site probably benign
R0788:Ptprf UTSW 4 118,083,663 (GRCm39) missense probably damaging 0.97
R1164:Ptprf UTSW 4 118,114,689 (GRCm39) missense probably damaging 1.00
R1478:Ptprf UTSW 4 118,069,302 (GRCm39) nonsense probably null
R1483:Ptprf UTSW 4 118,093,161 (GRCm39) missense possibly damaging 0.81
R1611:Ptprf UTSW 4 118,093,430 (GRCm39) missense probably benign 0.34
R1721:Ptprf UTSW 4 118,082,096 (GRCm39) missense possibly damaging 0.56
R1817:Ptprf UTSW 4 118,080,462 (GRCm39) missense probably benign 0.02
R1818:Ptprf UTSW 4 118,067,068 (GRCm39) missense probably damaging 1.00
R1860:Ptprf UTSW 4 118,081,129 (GRCm39) missense probably damaging 1.00
R2208:Ptprf UTSW 4 118,126,369 (GRCm39) splice site probably benign
R2406:Ptprf UTSW 4 118,126,501 (GRCm39) missense possibly damaging 0.62
R2912:Ptprf UTSW 4 118,106,177 (GRCm39) missense probably damaging 0.98
R3111:Ptprf UTSW 4 118,068,629 (GRCm39) missense probably damaging 1.00
R3498:Ptprf UTSW 4 118,082,127 (GRCm39) missense probably damaging 0.99
R3499:Ptprf UTSW 4 118,082,127 (GRCm39) missense probably damaging 0.99
R3615:Ptprf UTSW 4 118,095,080 (GRCm39) missense probably benign 0.04
R3616:Ptprf UTSW 4 118,095,080 (GRCm39) missense probably benign 0.04
R4038:Ptprf UTSW 4 118,114,805 (GRCm39) missense probably damaging 1.00
R4243:Ptprf UTSW 4 118,083,649 (GRCm39) critical splice donor site probably null
R4260:Ptprf UTSW 4 118,083,280 (GRCm39) missense possibly damaging 0.64
R4693:Ptprf UTSW 4 118,068,219 (GRCm39) missense probably benign 0.16
R4726:Ptprf UTSW 4 118,069,414 (GRCm39) missense possibly damaging 0.86
R4746:Ptprf UTSW 4 118,082,236 (GRCm39) missense possibly damaging 0.83
R4802:Ptprf UTSW 4 118,067,526 (GRCm39) intron probably benign
R4857:Ptprf UTSW 4 118,074,394 (GRCm39) splice site probably benign
R5071:Ptprf UTSW 4 118,069,196 (GRCm39) missense probably damaging 1.00
R5221:Ptprf UTSW 4 118,082,305 (GRCm39) missense probably benign 0.00
R5327:Ptprf UTSW 4 118,093,586 (GRCm39) missense probably damaging 1.00
R5336:Ptprf UTSW 4 118,092,831 (GRCm39) missense probably damaging 1.00
R5356:Ptprf UTSW 4 118,083,535 (GRCm39) missense probably benign 0.00
R5373:Ptprf UTSW 4 118,083,238 (GRCm39) missense possibly damaging 0.93
R5555:Ptprf UTSW 4 118,082,121 (GRCm39) missense probably damaging 1.00
R5693:Ptprf UTSW 4 118,093,374 (GRCm39) nonsense probably null
R5860:Ptprf UTSW 4 118,068,486 (GRCm39) intron probably benign
R5869:Ptprf UTSW 4 118,067,579 (GRCm39) missense probably damaging 1.00
R5890:Ptprf UTSW 4 118,081,932 (GRCm39) missense probably benign
R5932:Ptprf UTSW 4 118,068,964 (GRCm39) missense probably benign 0.10
R6028:Ptprf UTSW 4 118,070,826 (GRCm39) missense probably benign 0.01
R6030:Ptprf UTSW 4 118,068,245 (GRCm39) missense probably benign 0.19
R6030:Ptprf UTSW 4 118,068,245 (GRCm39) missense probably benign 0.19
R6088:Ptprf UTSW 4 118,067,952 (GRCm39) missense possibly damaging 0.68
R6089:Ptprf UTSW 4 118,068,281 (GRCm39) missense probably damaging 0.99
R6108:Ptprf UTSW 4 118,080,453 (GRCm39) missense probably benign 0.01
R6320:Ptprf UTSW 4 118,070,011 (GRCm39) missense probably benign
R6741:Ptprf UTSW 4 118,080,565 (GRCm39) missense probably benign 0.00
R6750:Ptprf UTSW 4 118,088,928 (GRCm39) missense probably benign 0.03
R6906:Ptprf UTSW 4 118,126,474 (GRCm39) missense possibly damaging 0.95
R7021:Ptprf UTSW 4 118,081,101 (GRCm39) missense probably benign 0.00
R7153:Ptprf UTSW 4 118,088,740 (GRCm39) missense probably damaging 1.00
R7326:Ptprf UTSW 4 118,088,866 (GRCm39) missense probably damaging 0.99
R7337:Ptprf UTSW 4 118,068,322 (GRCm39) missense probably damaging 0.99
R7374:Ptprf UTSW 4 118,114,689 (GRCm39) missense probably damaging 1.00
R7375:Ptprf UTSW 4 118,070,011 (GRCm39) missense probably benign
R7399:Ptprf UTSW 4 118,083,720 (GRCm39) missense probably benign 0.28
R7417:Ptprf UTSW 4 118,069,369 (GRCm39) missense probably damaging 1.00
R7448:Ptprf UTSW 4 118,092,864 (GRCm39) missense probably benign 0.03
R7530:Ptprf UTSW 4 118,069,945 (GRCm39) missense probably damaging 1.00
R7593:Ptprf UTSW 4 118,069,593 (GRCm39) missense probably benign 0.00
R8172:Ptprf UTSW 4 118,068,275 (GRCm39) missense probably benign 0.03
R8239:Ptprf UTSW 4 118,069,309 (GRCm39) missense possibly damaging 0.88
R8257:Ptprf UTSW 4 118,083,476 (GRCm39) missense probably damaging 0.96
R8331:Ptprf UTSW 4 118,083,263 (GRCm39) missense probably benign 0.27
R8441:Ptprf UTSW 4 118,075,255 (GRCm39) splice site probably benign
R8681:Ptprf UTSW 4 118,088,844 (GRCm39) missense probably benign 0.02
R8771:Ptprf UTSW 4 118,068,987 (GRCm39) missense possibly damaging 0.95
R8815:Ptprf UTSW 4 118,095,125 (GRCm39) missense possibly damaging 0.52
R8998:Ptprf UTSW 4 118,083,671 (GRCm39) missense probably benign 0.00
R8999:Ptprf UTSW 4 118,083,671 (GRCm39) missense probably benign 0.00
R9389:Ptprf UTSW 4 118,093,236 (GRCm39) missense probably benign
R9508:Ptprf UTSW 4 118,126,776 (GRCm39) nonsense probably null
R9581:Ptprf UTSW 4 118,092,257 (GRCm39) missense probably benign 0.00
X0067:Ptprf UTSW 4 118,093,223 (GRCm39) missense possibly damaging 0.85
Z1177:Ptprf UTSW 4 118,126,812 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTAAGCATTCGAGCCTGCAC -3'
(R):5'- ATCAACCACACTCAGGTGGC -3'

Sequencing Primer
(F):5'- TCGAGCCTGCACACGGC -3'
(R):5'- ACACTCAGGTGGCCGTAC -3'
Posted On 2018-08-29