Incidental Mutation 'R6744:Tmem214'
ID532774
Institutional Source Beutler Lab
Gene Symbol Tmem214
Ensembl Gene ENSMUSG00000038828
Gene Nametransmembrane protein 214
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R6744 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location30868012-30879180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30874028 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 409 (K409E)
Ref Sequence ENSEMBL: ENSMUSP00000144615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114716] [ENSMUST00000201203]
Predicted Effect probably damaging
Transcript: ENSMUST00000114716
AA Change: K364E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110364
Gene: ENSMUSG00000038828
AA Change: K364E

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 172 638 8e-247 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201203
AA Change: K409E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144615
Gene: ENSMUSG00000038828
AA Change: K409E

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 217 683 6.9e-246 PFAM
Meta Mutation Damage Score 0.8393 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T A 10: 20,965,567 L251H probably damaging Het
Alk A T 17: 72,603,082 S210T probably benign Het
Arap2 A G 5: 62,748,938 F246S probably damaging Het
Atad5 T A 11: 80,134,032 N1749K probably benign Het
C130060K24Rik T A 6: 65,441,340 M164K possibly damaging Het
C87436 T A 6: 86,446,064 S207T probably damaging Het
C8b C T 4: 104,774,346 R53W probably damaging Het
Catsperg2 A G 7: 29,709,819 V619A probably benign Het
Cdc73 G A 1: 143,702,149 probably benign Het
Cdh4 C A 2: 179,847,387 H297Q possibly damaging Het
Col3a1 G T 1: 45,338,622 probably benign Het
Crybg2 A G 4: 134,088,896 N1328S probably damaging Het
Ctnnb1 T A 9: 120,952,959 V346E probably damaging Het
Ctns C T 11: 73,185,285 G308E probably damaging Het
Cxxc4 AGGCGGCGGCGGCGGCGGCGGCGGC AGGCGGCGGCGGCGGCGGCGGCGGCGGC 3: 134,240,130 probably benign Het
Dnah6 A G 6: 73,037,549 I3685T probably damaging Het
Dock6 T C 9: 21,831,474 H775R probably damaging Het
Fbxl3 A T 14: 103,083,294 V239D probably damaging Het
Gh T A 11: 106,301,404 K55* probably null Het
Gm49333 A T 16: 20,630,366 K165N probably damaging Het
Havcr2 T G 11: 46,455,060 probably null Het
Kcnq2 T A 2: 181,085,306 H576L possibly damaging Het
Kifap3 A G 1: 163,848,670 N398S probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Mblac1 A G 5: 138,194,420 E8G possibly damaging Het
Mtor C T 4: 148,458,655 T290I probably benign Het
Nceh1 T C 3: 27,241,789 Y400H probably damaging Het
Nek9 A G 12: 85,329,929 V226A probably benign Het
Olfr119 T A 17: 37,701,445 Y258* probably null Het
Olfr518 T C 7: 108,880,830 T259A probably damaging Het
Olfr710 A G 7: 106,944,534 S156P probably damaging Het
Otud4 C A 8: 79,673,778 Y1039* probably null Het
Pax4 T C 6: 28,442,397 H331R probably benign Het
Piezo2 A T 18: 63,032,889 Y2090* probably null Het
Ppp1r12a T A 10: 108,230,534 H195Q probably damaging Het
Ppp6r2 A G 15: 89,256,661 probably null Het
Prodh A G 16: 18,079,200 V23A probably benign Het
Psg20 G A 7: 18,674,580 T405I probably damaging Het
Ptprf T C 4: 118,236,365 D360G probably benign Het
Rad18 A T 6: 112,675,784 M284K probably damaging Het
Rgs17 T C 10: 5,842,567 K60E possibly damaging Het
Sec31a G T 5: 100,392,499 Q39K possibly damaging Het
Slc22a22 G T 15: 57,254,272 T291K possibly damaging Het
Sult2a6 C T 7: 14,222,545 E264K probably damaging Het
Syne2 C T 12: 76,074,447 R5896C probably damaging Het
Tctn1 A T 5: 122,264,146 V75D probably damaging Het
Vcan T C 13: 89,705,182 Y553C probably damaging Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Other mutations in Tmem214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Tmem214 APN 5 30876093 missense probably benign 0.15
IGL02119:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02123:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02124:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02126:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02186:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02395:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02396:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02397:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02400:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02403:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02404:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02539:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02544:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02934:Tmem214 APN 5 30871544 missense probably benign 0.26
PIT4382001:Tmem214 UTSW 5 30871451 missense possibly damaging 0.89
R0501:Tmem214 UTSW 5 30872532 missense probably damaging 1.00
R0519:Tmem214 UTSW 5 30869668 start codon destroyed probably null 0.98
R0675:Tmem214 UTSW 5 30871825 missense possibly damaging 0.70
R1204:Tmem214 UTSW 5 30875790 missense probably damaging 0.97
R1616:Tmem214 UTSW 5 30871563 nonsense probably null
R2096:Tmem214 UTSW 5 30876370 missense probably damaging 1.00
R2219:Tmem214 UTSW 5 30873631 missense possibly damaging 0.72
R5635:Tmem214 UTSW 5 30871517 missense probably damaging 1.00
R6003:Tmem214 UTSW 5 30870724 missense possibly damaging 0.52
R7208:Tmem214 UTSW 5 30870721 missense possibly damaging 0.52
R8155:Tmem214 UTSW 5 30871792 missense possibly damaging 0.56
R8335:Tmem214 UTSW 5 30872122 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGACAATTCTCCTCAGCCTTTG -3'
(R):5'- TCCTAGGTTCTTAGGGCTGAAAG -3'

Sequencing Primer
(F):5'- CCTTTGTGGCAGATGTCTTGTTAC -3'
(R):5'- TAGTTCTTTAAAGGACACCCCAGCTG -3'
Posted On2018-08-29