Mutagenetix > Incidental Mutation

Incidental Mutation 'R6744:Piezo2'

532810

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

044861-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6744 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 63032889 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 2090 (Y2090*)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000047480
AA Change: Y2090*

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: Y2090*

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137141

SMART Domains

Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
transmembrane domain	84	106	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	235	409	4.6e-78	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahi1	T	A	10: 20,965,567 (GRCm38)	L251H	probably damaging	Het
Alk	A	T	17: 72,603,082 (GRCm38)	S210T	probably benign	Het
Arap2	A	G	5: 62,748,938 (GRCm38)	F246S	probably damaging	Het
Atad5	T	A	11: 80,134,032 (GRCm38)	N1749K	probably benign	Het
C87436	T	A	6: 86,446,064 (GRCm38)	S207T	probably damaging	Het
C8b	C	T	4: 104,774,346 (GRCm38)	R53W	probably damaging	Het
Catsperg2	A	G	7: 29,709,819 (GRCm38)	V619A	probably benign	Het
Cdc73	G	A	1: 143,702,149 (GRCm38)		probably benign	Het
Cdh4	C	A	2: 179,847,387 (GRCm38)	H297Q	possibly damaging	Het
Col3a1	G	T	1: 45,338,622 (GRCm38)		probably benign	Het
Crybg2	A	G	4: 134,088,896 (GRCm38)	N1328S	probably damaging	Het
Ctnnb1	T	A	9: 120,952,959 (GRCm38)	V346E	probably damaging	Het
Ctns	C	T	11: 73,185,285 (GRCm38)	G308E	probably damaging	Het
Cxxc4	AGGCGGCGGCGGCGGCGGCGGCGGC	AGGCGGCGGCGGCGGCGGCGGCGGCGGC	3: 134,240,130 (GRCm38)		probably benign	Het
Dnah6	A	G	6: 73,037,549 (GRCm38)	I3685T	probably damaging	Het
Dock6	T	C	9: 21,831,474 (GRCm38)	H775R	probably damaging	Het
Eef1ece2	A	T	16: 20,630,366 (GRCm38)	K165N	probably damaging	Het
Fbxl3	A	T	14: 103,083,294 (GRCm38)	V239D	probably damaging	Het
Gh	T	A	11: 106,301,404 (GRCm38)	K55*	probably null	Het
Havcr2	T	G	11: 46,455,060 (GRCm38)		probably null	Het
Kcnq2	T	A	2: 181,085,306 (GRCm38)	H576L	possibly damaging	Het
Kifap3	A	G	1: 163,848,670 (GRCm38)	N398S	probably benign	Het
Lama5	G	A	2: 180,191,662 (GRCm38)	P1519L	probably damaging	Het
Mblac1	A	G	5: 138,194,420 (GRCm38)	E8G	possibly damaging	Het
Mtor	C	T	4: 148,458,655 (GRCm38)	T290I	probably benign	Het
Nceh1	T	C	3: 27,241,789 (GRCm38)	Y400H	probably damaging	Het
Nek9	A	G	12: 85,329,929 (GRCm38)	V226A	probably benign	Het
Or10a3	T	C	7: 108,880,830 (GRCm38)	T259A	probably damaging	Het
Or10al3	T	A	17: 37,701,445 (GRCm38)	Y258*	probably null	Het
Or2d4	A	G	7: 106,944,534 (GRCm38)	S156P	probably damaging	Het
Otud4	C	A	8: 79,673,778 (GRCm38)	Y1039*	probably null	Het
Pax4	T	C	6: 28,442,397 (GRCm38)	H331R	probably benign	Het
Ppp1r12a	T	A	10: 108,230,534 (GRCm38)	H195Q	probably damaging	Het
Ppp6r2	A	G	15: 89,256,661 (GRCm38)		probably null	Het
Prodh	A	G	16: 18,079,200 (GRCm38)	V23A	probably benign	Het
Psg20	G	A	7: 18,674,580 (GRCm38)	T405I	probably damaging	Het
Ptprf	T	C	4: 118,236,365 (GRCm38)	D360G	probably benign	Het
Qrfprl	T	A	6: 65,441,340 (GRCm38)	M164K	possibly damaging	Het
Rad18	A	T	6: 112,675,784 (GRCm38)	M284K	probably damaging	Het
Rgs17	T	C	10: 5,842,567 (GRCm38)	K60E	possibly damaging	Het
Sec31a	G	T	5: 100,392,499 (GRCm38)	Q39K	possibly damaging	Het
Slc22a22	G	T	15: 57,254,272 (GRCm38)	T291K	possibly damaging	Het
Sult2a6	C	T	7: 14,222,545 (GRCm38)	E264K	probably damaging	Het
Syne2	C	T	12: 76,074,447 (GRCm38)	R5896C	probably damaging	Het
Tctn1	A	T	5: 122,264,146 (GRCm38)	V75D	probably damaging	Het
Tmem214	A	G	5: 30,874,028 (GRCm38)	K409E	probably damaging	Het
Vcan	T	C	13: 89,705,182 (GRCm38)	Y553C	probably damaging	Het
Vmn1r49	C	T	6: 90,072,202 (GRCm38)	V273I	probably benign	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63,117,699 (GRCm38)	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63,022,460 (GRCm38)	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63,070,030 (GRCm38)	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63,124,614 (GRCm38)	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63,030,392 (GRCm38)	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63,182,833 (GRCm38)	splice site	probably benign
IGL01674:Piezo2	APN	18	63,027,559 (GRCm38)	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63,083,170 (GRCm38)	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63,042,788 (GRCm38)	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63,092,844 (GRCm38)	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63,020,634 (GRCm38)	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63,146,844 (GRCm38)	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63,072,862 (GRCm38)	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63,032,924 (GRCm38)	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63,024,475 (GRCm38)	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63,074,659 (GRCm38)	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63,020,633 (GRCm38)	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63,020,633 (GRCm38)	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63,064,785 (GRCm38)	splice site	probably benign
IGL03011:Piezo2	APN	18	63,124,660 (GRCm38)	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63,070,075 (GRCm38)	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63,030,272 (GRCm38)	splice site	probably null
IGL03129:Piezo2	APN	18	63,114,972 (GRCm38)	missense	probably benign
IGL03143:Piezo2	APN	18	63,108,076 (GRCm38)	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63,011,598 (GRCm38)	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63,124,606 (GRCm38)	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63,053,062 (GRCm38)	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63,041,720 (GRCm38)	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63,011,538 (GRCm38)	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63,021,308 (GRCm38)	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63,027,704 (GRCm38)	missense	probably damaging	1.00
Piccolo	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
sopranino	UTSW	18	63,024,466 (GRCm38)	missense	probably damaging	1.00
woodwind	UTSW	18	63,124,642 (GRCm38)	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63,386,200 (GRCm38)	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63,024,469 (GRCm38)	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63,102,084 (GRCm38)	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63,024,491 (GRCm38)	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63,029,061 (GRCm38)	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63,102,174 (GRCm38)	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63,024,451 (GRCm38)	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63,027,544 (GRCm38)	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63,022,481 (GRCm38)	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63,022,426 (GRCm38)	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63,019,258 (GRCm38)	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63,041,723 (GRCm38)	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63,083,235 (GRCm38)	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63,015,802 (GRCm38)	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63,086,753 (GRCm38)	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63,021,254 (GRCm38)	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63,083,131 (GRCm38)	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63,144,919 (GRCm38)	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63,082,915 (GRCm38)	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63,117,672 (GRCm38)	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63,021,173 (GRCm38)	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63,124,642 (GRCm38)	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63,106,284 (GRCm38)	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63,108,087 (GRCm38)	missense	probably damaging	1.00
R1799:Piezo2	UTSW	18	63,032,840 (GRCm38)	critical splice donor site	probably null
R1868:Piezo2	UTSW	18	63,019,344 (GRCm38)	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63,113,960 (GRCm38)	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63,078,840 (GRCm38)	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63,078,781 (GRCm38)	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63,144,926 (GRCm38)	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63,059,744 (GRCm38)	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63,118,935 (GRCm38)	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63,081,734 (GRCm38)	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63,117,720 (GRCm38)	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63,114,041 (GRCm38)	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63,106,274 (GRCm38)	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63,145,072 (GRCm38)	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63,145,072 (GRCm38)	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63,022,525 (GRCm38)	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63,245,624 (GRCm38)	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63,053,035 (GRCm38)	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63,146,843 (GRCm38)	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63,024,435 (GRCm38)	nonsense	probably null
R3016:Piezo2	UTSW	18	63,042,832 (GRCm38)	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63,081,793 (GRCm38)	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63,050,604 (GRCm38)	missense	probably benign
R4181:Piezo2	UTSW	18	63,124,730 (GRCm38)	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63,084,840 (GRCm38)	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63,124,730 (GRCm38)	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63,102,099 (GRCm38)	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63,114,063 (GRCm38)	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63,072,880 (GRCm38)	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63,086,628 (GRCm38)	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63,069,963 (GRCm38)	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63,030,401 (GRCm38)	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63,030,401 (GRCm38)	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63,144,954 (GRCm38)	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63,078,791 (GRCm38)	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63,157,262 (GRCm38)	missense	probably benign
R4961:Piezo2	UTSW	18	63,052,961 (GRCm38)	splice site	probably null
R4968:Piezo2	UTSW	18	63,144,971 (GRCm38)	nonsense	probably null
R4973:Piezo2	UTSW	18	63,074,680 (GRCm38)	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63,083,113 (GRCm38)	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63,024,536 (GRCm38)	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63,074,620 (GRCm38)	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63,030,409 (GRCm38)	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63,032,929 (GRCm38)	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63,064,731 (GRCm38)	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63,084,740 (GRCm38)	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63,145,105 (GRCm38)	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63,027,864 (GRCm38)	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63,011,721 (GRCm38)	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63,145,091 (GRCm38)	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63,117,697 (GRCm38)	missense	probably benign	0.25
R5677:Piezo2	UTSW	18	63,117,696 (GRCm38)	missense	possibly damaging	0.94
R5792:Piezo2	UTSW	18	63,146,856 (GRCm38)	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63,027,901 (GRCm38)	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63,113,934 (GRCm38)	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63,114,948 (GRCm38)	nonsense	probably null
R6036:Piezo2	UTSW	18	63,114,948 (GRCm38)	nonsense	probably null
R6073:Piezo2	UTSW	18	63,012,645 (GRCm38)	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63,157,210 (GRCm38)	nonsense	probably null
R6255:Piezo2	UTSW	18	63,121,270 (GRCm38)	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63,117,678 (GRCm38)	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63,106,293 (GRCm38)	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63,086,607 (GRCm38)	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63,041,663 (GRCm38)	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63,106,271 (GRCm38)	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63,021,328 (GRCm38)	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63,021,262 (GRCm38)	missense	probably damaging	1.00
R6855:Piezo2	UTSW	18	63,090,879 (GRCm38)	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63,032,986 (GRCm38)	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63,082,961 (GRCm38)	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63,145,110 (GRCm38)	nonsense	probably null
R7162:Piezo2	UTSW	18	63,124,709 (GRCm38)	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63,108,030 (GRCm38)	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63,017,519 (GRCm38)	splice site	probably null
R7395:Piezo2	UTSW	18	63,027,563 (GRCm38)	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63,024,472 (GRCm38)	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63,012,723 (GRCm38)	missense	probably benign
R7517:Piezo2	UTSW	18	63,082,925 (GRCm38)	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63,053,010 (GRCm38)	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63,042,539 (GRCm38)	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63,113,876 (GRCm38)	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63,082,945 (GRCm38)	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63,083,200 (GRCm38)	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63,042,811 (GRCm38)	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63,030,466 (GRCm38)	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63,075,730 (GRCm38)	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63,012,786 (GRCm38)	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63,090,998 (GRCm38)	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63,084,688 (GRCm38)	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63,090,998 (GRCm38)	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63,045,540 (GRCm38)	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63,146,802 (GRCm38)	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63,092,900 (GRCm38)	nonsense	probably null
R8708:Piezo2	UTSW	18	63,093,015 (GRCm38)	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63,109,885 (GRCm38)	missense	probably benign
R8727:Piezo2	UTSW	18	63,109,885 (GRCm38)	missense	probably benign
R8810:Piezo2	UTSW	18	63,114,963 (GRCm38)	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63,115,025 (GRCm38)	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63,092,831 (GRCm38)	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63,024,466 (GRCm38)	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63,075,719 (GRCm38)	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63,030,379 (GRCm38)	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63,045,518 (GRCm38)	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63,045,518 (GRCm38)	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63,045,479 (GRCm38)	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63,117,744 (GRCm38)	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63,157,231 (GRCm38)	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63,021,301 (GRCm38)	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63,075,797 (GRCm38)	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63,030,379 (GRCm38)	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63,075,719 (GRCm38)	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63,024,566 (GRCm38)	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63,029,085 (GRCm38)	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63,032,962 (GRCm38)	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63,102,165 (GRCm38)	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63,032,962 (GRCm38)	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63,386,276 (GRCm38)	start gained	probably benign
R9608:Piezo2	UTSW	18	63,146,945 (GRCm38)	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63,115,037 (GRCm38)	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63,064,696 (GRCm38)	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63,027,586 (GRCm38)	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63,050,610 (GRCm38)	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63,017,577 (GRCm38)	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63,069,994 (GRCm38)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AACTAGTGCAGAGGTGATATCG -3'
(R):5'- TCTACCACCAAAACTGTGAGGC -3'

Sequencing Primer
(F):5'- GGTGATATCGCCTCTCCTTCAAG -3'
(R):5'- GCATTGCTATTCCCGGGAG -3'

Posted On

2018-08-29