Incidental Mutation 'R6746:Gm5415'
ID 532811
Institutional Source Beutler Lab
Gene Symbol Gm5415
Ensembl Gene ENSMUSG00000091318
Gene Name predicted gene 5415
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock # R6746 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 32543686-32547294 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32546763 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 22 (I22N)
Ref Sequence ENSEMBL: ENSMUSP00000132789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027226] [ENSMUST00000171322]
AlphaFold E9PXF3
Predicted Effect probably benign
Transcript: ENSMUST00000027226
SMART Domains Protein: ENSMUSP00000027226
Gene: ENSMUSG00000026058

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 156 4.93e-7 SMART
low complexity region 185 197 N/A INTRINSIC
low complexity region 204 231 N/A INTRINSIC
Pfam:Sam68-YY 267 321 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171322
AA Change: I22N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132789
Gene: ENSMUSG00000091318
AA Change: I22N

DomainStartEndE-ValueType
low complexity region 137 150 N/A INTRINSIC
Pfam:Peptidase_C48 298 477 7.4e-44 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,346,221 L79* probably null Het
Acot3 A G 12: 84,053,474 N8S probably benign Het
Adora2a T C 10: 75,333,608 V302A probably benign Het
Anpep A C 7: 79,839,185 probably null Het
Arrb1 A G 7: 99,601,150 K392E probably benign Het
Atp8a1 A T 5: 67,751,049 N444K probably benign Het
Brinp2 C T 1: 158,266,590 G181R probably benign Het
Cacna1g A T 11: 94,409,427 C2184* probably null Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Ccdc155 C T 7: 45,200,311 V63I probably benign Het
Ccdc30 T C 4: 119,356,718 T205A probably benign Het
Celsr1 A G 15: 86,031,495 I759T probably damaging Het
Chaf1a A G 17: 56,063,404 D623G possibly damaging Het
Col6a3 G T 1: 90,779,045 N2115K unknown Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Erich6 T C 3: 58,616,566 D629G possibly damaging Het
Fahd1 G T 17: 24,849,941 A54E probably damaging Het
Flrt3 C T 2: 140,660,025 R561Q probably damaging Het
Grm6 A T 11: 50,856,963 D334V probably damaging Het
Helb A T 10: 120,105,468 D438E probably damaging Het
Hmgcs1 T C 13: 119,695,049 probably null Het
Hnf4g C A 3: 3,657,110 Y441* probably null Het
Hrasls5 A G 19: 7,613,330 D74G probably benign Het
Hspa13 A T 16: 75,765,037 N91K possibly damaging Het
Ilvbl T C 10: 78,577,223 I193T possibly damaging Het
Itga7 T C 10: 128,949,472 V848A probably benign Het
Lpin1 A G 12: 16,565,528 M341T probably benign Het
Lypd5 G T 7: 24,353,106 probably null Het
Mrgprb1 A C 7: 48,447,897 V89G possibly damaging Het
Nsun7 T C 5: 66,283,737 probably null Het
Oasl1 T A 5: 114,937,183 V434E probably damaging Het
Olfr1008 T C 2: 85,689,608 Y60H probably damaging Het
Olfr319 G A 11: 58,702,543 V281I probably benign Het
Olfr837 A G 9: 19,137,478 M162V probably benign Het
Otor T A 2: 143,080,035 probably null Het
Pik3cg G A 12: 32,194,758 T899M probably damaging Het
Pld2 C A 11: 70,541,107 L52M probably damaging Het
Pon3 A T 6: 5,230,786 M247K possibly damaging Het
Ppfia2 C A 10: 106,906,458 Y1037* probably null Het
Ppm1m A T 9: 106,198,152 C99* probably null Het
Prss44 A T 9: 110,815,293 *145C probably null Het
Ptpro T A 6: 137,394,823 Y613N probably damaging Het
Ralgapb T G 2: 158,476,136 V866G probably damaging Het
Rassf6 C A 5: 90,609,774 R109L possibly damaging Het
Rbm4b A C 19: 4,762,003 T147P probably benign Het
Rpl7l1 T C 17: 46,779,396 K104R probably benign Het
Ryr1 A T 7: 29,117,404 I69N possibly damaging Het
Scd1 G T 19: 44,406,488 F99L probably benign Het
Spint2 A T 7: 29,259,423 S66T probably benign Het
Tarm1 T A 7: 3,502,462 I2F probably benign Het
Tenm4 T C 7: 96,892,860 V1860A probably damaging Het
Uhrf1bp1l T A 10: 89,787,158 N298K probably benign Het
Usp38 A G 8: 81,014,291 I49T possibly damaging Het
Vars2 A G 17: 35,660,402 probably null Het
Vmn2r27 T G 6: 124,200,593 H484P possibly damaging Het
Wdr35 T A 12: 9,003,982 probably null Het
Zfp937 A T 2: 150,239,423 K458* probably null Het
Other mutations in Gm5415
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Gm5415 APN 1 32546667 missense probably benign
IGL01148:Gm5415 APN 1 32545654 missense possibly damaging 0.88
IGL02323:Gm5415 APN 1 32545704 nonsense probably null
IGL03076:Gm5415 APN 1 32545545 missense probably damaging 1.00
IGL03288:Gm5415 APN 1 32545760 missense probably benign 0.09
PIT4576001:Gm5415 UTSW 1 32546472 missense probably damaging 1.00
R0110:Gm5415 UTSW 1 32545875 missense possibly damaging 0.87
R0510:Gm5415 UTSW 1 32545875 missense possibly damaging 0.87
R0891:Gm5415 UTSW 1 32546361 missense possibly damaging 0.54
R1836:Gm5415 UTSW 1 32545677 missense probably damaging 1.00
R1939:Gm5415 UTSW 1 32545546 missense probably damaging 0.99
R2156:Gm5415 UTSW 1 32546047 missense probably benign 0.08
R2226:Gm5415 UTSW 1 32545853 missense probably damaging 1.00
R2422:Gm5415 UTSW 1 32545861 missense possibly damaging 0.73
R4761:Gm5415 UTSW 1 32546507 missense possibly damaging 0.51
R4901:Gm5415 UTSW 1 32546620 missense probably benign 0.00
R5129:Gm5415 UTSW 1 32545479 missense probably damaging 1.00
R5129:Gm5415 UTSW 1 32545480 missense probably damaging 1.00
R5184:Gm5415 UTSW 1 32545648 missense probably damaging 0.99
R5259:Gm5415 UTSW 1 32545517 nonsense probably null
R6271:Gm5415 UTSW 1 32545491 missense probably damaging 1.00
R6589:Gm5415 UTSW 1 32546711 missense probably benign 0.44
R7720:Gm5415 UTSW 1 32546097 missense probably benign 0.00
R7855:Gm5415 UTSW 1 32546033 missense probably damaging 0.96
R8006:Gm5415 UTSW 1 32546924 start gained probably benign
R8177:Gm5415 UTSW 1 32546376 missense probably benign
R8946:Gm5415 UTSW 1 32546604 missense probably benign 0.02
R9172:Gm5415 UTSW 1 32546084 missense probably benign
R9455:Gm5415 UTSW 1 32546826 start codon destroyed probably null
X0024:Gm5415 UTSW 1 32545711 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TTACAACCTGCTCTGGAGGACC -3'
(R):5'- TGAGCCAGGCATAAGGTTGC -3'

Sequencing Primer
(F):5'- ACCTTCGGTCAACTCTAGGG -3'
(R):5'- CTTTTGCTTGGAAAGTGAAAGAGCAC -3'
Posted On 2018-08-29