Incidental Mutation 'R6746:Hnf4g'
ID 532819
Institutional Source Beutler Lab
Gene Symbol Hnf4g
Ensembl Gene ENSMUSG00000017688
Gene Name hepatocyte nuclear factor 4, gamma
Synonyms NR2A2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock # R6746 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 3508030-3658052 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 3657110 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 441 (Y441*)
Ref Sequence ENSEMBL: ENSMUSP00000104031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108393] [ENSMUST00000108394]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000108393
AA Change: Y397*
SMART Domains Protein: ENSMUSP00000104030
Gene: ENSMUSG00000017688
AA Change: Y397*

DomainStartEndE-ValueType
ZnF_C4 9 80 6.51e-35 SMART
low complexity region 118 125 N/A INTRINSIC
HOLI 141 299 7.29e-47 SMART
low complexity region 334 345 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108394
AA Change: Y441*
SMART Domains Protein: ENSMUSP00000104031
Gene: ENSMUSG00000017688
AA Change: Y441*

DomainStartEndE-ValueType
ZnF_C4 63 134 6.51e-35 SMART
low complexity region 172 179 N/A INTRINSIC
HOLI 195 353 7.29e-47 SMART
low complexity region 388 399 N/A INTRINSIC
Meta Mutation Damage Score 0.9713 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are less inclined to build nests, spend more time in a passive state during the forced swim test, and display a reduction in energy expenditure and night time activity that results in increased body weight despite adecreased intake of food and water. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,346,221 L79* probably null Het
Acot3 A G 12: 84,053,474 N8S probably benign Het
Adora2a T C 10: 75,333,608 V302A probably benign Het
Anpep A C 7: 79,839,185 probably null Het
Arrb1 A G 7: 99,601,150 K392E probably benign Het
Atp8a1 A T 5: 67,751,049 N444K probably benign Het
Brinp2 C T 1: 158,266,590 G181R probably benign Het
Cacna1g A T 11: 94,409,427 C2184* probably null Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Ccdc155 C T 7: 45,200,311 V63I probably benign Het
Ccdc30 T C 4: 119,356,718 T205A probably benign Het
Celsr1 A G 15: 86,031,495 I759T probably damaging Het
Chaf1a A G 17: 56,063,404 D623G possibly damaging Het
Col6a3 G T 1: 90,779,045 N2115K unknown Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Erich6 T C 3: 58,616,566 D629G possibly damaging Het
Fahd1 G T 17: 24,849,941 A54E probably damaging Het
Flrt3 C T 2: 140,660,025 R561Q probably damaging Het
Gm5415 A T 1: 32,546,763 I22N probably benign Het
Grm6 A T 11: 50,856,963 D334V probably damaging Het
Helb A T 10: 120,105,468 D438E probably damaging Het
Hmgcs1 T C 13: 119,695,049 probably null Het
Hrasls5 A G 19: 7,613,330 D74G probably benign Het
Hspa13 A T 16: 75,765,037 N91K possibly damaging Het
Ilvbl T C 10: 78,577,223 I193T possibly damaging Het
Itga7 T C 10: 128,949,472 V848A probably benign Het
Lpin1 A G 12: 16,565,528 M341T probably benign Het
Lypd5 G T 7: 24,353,106 probably null Het
Mrgprb1 A C 7: 48,447,897 V89G possibly damaging Het
Nsun7 T C 5: 66,283,737 probably null Het
Oasl1 T A 5: 114,937,183 V434E probably damaging Het
Olfr1008 T C 2: 85,689,608 Y60H probably damaging Het
Olfr319 G A 11: 58,702,543 V281I probably benign Het
Olfr837 A G 9: 19,137,478 M162V probably benign Het
Otor T A 2: 143,080,035 probably null Het
Pik3cg G A 12: 32,194,758 T899M probably damaging Het
Pld2 C A 11: 70,541,107 L52M probably damaging Het
Pon3 A T 6: 5,230,786 M247K possibly damaging Het
Ppfia2 C A 10: 106,906,458 Y1037* probably null Het
Ppm1m A T 9: 106,198,152 C99* probably null Het
Prss44 A T 9: 110,815,293 *145C probably null Het
Ptpro T A 6: 137,394,823 Y613N probably damaging Het
Ralgapb T G 2: 158,476,136 V866G probably damaging Het
Rassf6 C A 5: 90,609,774 R109L possibly damaging Het
Rbm4b A C 19: 4,762,003 T147P probably benign Het
Rpl7l1 T C 17: 46,779,396 K104R probably benign Het
Ryr1 A T 7: 29,117,404 I69N possibly damaging Het
Scd1 G T 19: 44,406,488 F99L probably benign Het
Spint2 A T 7: 29,259,423 S66T probably benign Het
Tarm1 T A 7: 3,502,462 I2F probably benign Het
Tenm4 T C 7: 96,892,860 V1860A probably damaging Het
Uhrf1bp1l T A 10: 89,787,158 N298K probably benign Het
Usp38 A G 8: 81,014,291 I49T possibly damaging Het
Vars2 A G 17: 35,660,402 probably null Het
Vmn2r27 T G 6: 124,200,593 H484P possibly damaging Het
Wdr35 T A 12: 9,003,982 probably null Het
Zfp937 A T 2: 150,239,423 K458* probably null Het
Other mutations in Hnf4g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hnf4g APN 3 3648082 missense probably benign
IGL00832:Hnf4g APN 3 3641276 missense probably damaging 1.00
IGL01571:Hnf4g APN 3 3651266 splice site probably benign
IGL01896:Hnf4g APN 3 3651410 missense probably damaging 1.00
IGL02068:Hnf4g APN 3 3644576 missense probably benign
IGL03040:Hnf4g APN 3 3634211 utr 5 prime probably benign
IGL03097:Hnf4g UTSW 3 3651614 missense probably damaging 1.00
R0124:Hnf4g UTSW 3 3643082 splice site probably benign
R0477:Hnf4g UTSW 3 3651791 splice site probably benign
R0512:Hnf4g UTSW 3 3651622 missense probably damaging 1.00
R0744:Hnf4g UTSW 3 3651629 missense possibly damaging 0.92
R1323:Hnf4g UTSW 3 3634221 missense possibly damaging 0.73
R1323:Hnf4g UTSW 3 3634221 missense possibly damaging 0.73
R1656:Hnf4g UTSW 3 3652951 missense probably benign
R1982:Hnf4g UTSW 3 3638208 missense probably damaging 0.99
R2336:Hnf4g UTSW 3 3641224 missense probably benign 0.25
R3104:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3105:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3106:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3843:Hnf4g UTSW 3 3651302 missense probably benign 0.09
R4200:Hnf4g UTSW 3 3651284 missense possibly damaging 0.94
R4248:Hnf4g UTSW 3 3652849 missense possibly damaging 0.69
R4418:Hnf4g UTSW 3 3648094 missense possibly damaging 0.66
R4756:Hnf4g UTSW 3 3643009 missense possibly damaging 0.69
R4871:Hnf4g UTSW 3 3651388 missense possibly damaging 0.94
R5022:Hnf4g UTSW 3 3644587 missense probably damaging 0.99
R5023:Hnf4g UTSW 3 3644587 missense probably damaging 0.99
R5088:Hnf4g UTSW 3 3657121 missense probably benign 0.09
R5604:Hnf4g UTSW 3 3657126 nonsense probably null
R7088:Hnf4g UTSW 3 3648125 splice site probably null
R7335:Hnf4g UTSW 3 3652864 missense possibly damaging 0.93
R8153:Hnf4g UTSW 3 3634190 start gained probably benign
R8182:Hnf4g UTSW 3 3651619 missense possibly damaging 0.82
R8676:Hnf4g UTSW 3 3643073 splice site probably benign
R9008:Hnf4g UTSW 3 3643036 missense probably benign
R9153:Hnf4g UTSW 3 3508318 start gained probably benign
R9671:Hnf4g UTSW 3 3638213 missense probably benign 0.00
R9802:Hnf4g UTSW 3 3634344 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTGTTTATCATGCCCATTGATC -3'
(R):5'- CCATGAAGAAGCCTTGCCTG -3'

Sequencing Primer
(F):5'- TGAGAATGCTCTGCCATTAGC -3'
(R):5'- AAGCCTTGCCTGAAGTAGAC -3'
Posted On 2018-08-29