Incidental Mutation 'R6746:Rassf6'
ID532824
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene NameRas association (RalGDS/AF-6) domain family member 6
Synonyms1600016B17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6746 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location90603076-90640657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90609774 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 109 (R109L)
Ref Sequence ENSEMBL: ENSMUSP00000144337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031317
AA Change: R109L

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370
AA Change: R109L

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202704
AA Change: R109L

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370
AA Change: R109L

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202784
AA Change: R109L

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370
AA Change: R109L

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000202807
AA Change: R9L
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,346,221 L79* probably null Het
Acot3 A G 12: 84,053,474 N8S probably benign Het
Adora2a T C 10: 75,333,608 V302A probably benign Het
Anpep A C 7: 79,839,185 probably null Het
Arrb1 A G 7: 99,601,150 K392E probably benign Het
Atp8a1 A T 5: 67,751,049 N444K probably benign Het
Brinp2 C T 1: 158,266,590 G181R probably benign Het
Cacna1g A T 11: 94,409,427 C2184* probably null Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Ccdc155 C T 7: 45,200,311 V63I probably benign Het
Ccdc30 T C 4: 119,356,718 T205A probably benign Het
Celsr1 A G 15: 86,031,495 I759T probably damaging Het
Chaf1a A G 17: 56,063,404 D623G possibly damaging Het
Col6a3 G T 1: 90,779,045 N2115K unknown Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Erich6 T C 3: 58,616,566 D629G possibly damaging Het
Fahd1 G T 17: 24,849,941 A54E probably damaging Het
Flrt3 C T 2: 140,660,025 R561Q probably damaging Het
Gm5415 A T 1: 32,546,763 I22N probably benign Het
Grm6 A T 11: 50,856,963 D334V probably damaging Het
Helb A T 10: 120,105,468 D438E probably damaging Het
Hmgcs1 T C 13: 119,695,049 probably null Het
Hnf4g C A 3: 3,657,110 Y441* probably null Het
Hrasls5 A G 19: 7,613,330 D74G probably benign Het
Hspa13 A T 16: 75,765,037 N91K possibly damaging Het
Ilvbl T C 10: 78,577,223 I193T possibly damaging Het
Itga7 T C 10: 128,949,472 V848A probably benign Het
Lpin1 A G 12: 16,565,528 M341T probably benign Het
Lypd5 G T 7: 24,353,106 probably null Het
Mrgprb1 A C 7: 48,447,897 V89G possibly damaging Het
Nsun7 T C 5: 66,283,737 probably null Het
Oasl1 T A 5: 114,937,183 V434E probably damaging Het
Olfr1008 T C 2: 85,689,608 Y60H probably damaging Het
Olfr319 G A 11: 58,702,543 V281I probably benign Het
Olfr837 A G 9: 19,137,478 M162V probably benign Het
Otor T A 2: 143,080,035 probably null Het
Pik3cg G A 12: 32,194,758 T899M probably damaging Het
Pld2 C A 11: 70,541,107 L52M probably damaging Het
Pon3 A T 6: 5,230,786 M247K possibly damaging Het
Ppfia2 C A 10: 106,906,458 Y1037* probably null Het
Ppm1m A T 9: 106,198,152 C99* probably null Het
Prss44 A T 9: 110,815,293 *145C probably null Het
Ptpro T A 6: 137,394,823 Y613N probably damaging Het
Ralgapb T G 2: 158,476,136 V866G probably damaging Het
Rbm4b A C 19: 4,762,003 T147P probably benign Het
Rpl7l1 T C 17: 46,779,396 K104R probably benign Het
Ryr1 A T 7: 29,117,404 I69N possibly damaging Het
Scd1 G T 19: 44,406,488 F99L probably benign Het
Spint2 A T 7: 29,259,423 S66T probably benign Het
Tarm1 T A 7: 3,502,462 I2F probably benign Het
Tenm4 T C 7: 96,892,860 V1860A probably damaging Het
Uhrf1bp1l T A 10: 89,787,158 N298K probably benign Het
Usp38 A G 8: 81,014,291 I49T possibly damaging Het
Vars2 A G 17: 35,660,402 probably null Het
Vmn2r27 T G 6: 124,200,593 H484P possibly damaging Het
Wdr35 T A 12: 9,003,982 probably null Het
Zfp937 A T 2: 150,239,423 K458* probably null Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90604140 missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90604071 missense probably benign 0.03
IGL01139:Rassf6 APN 5 90608966 makesense probably null
IGL03114:Rassf6 APN 5 90608790 splice site probably benign
R1956:Rassf6 UTSW 5 90615871 nonsense probably null
R2167:Rassf6 UTSW 5 90603938 missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90631559 missense probably benign 0.05
R2877:Rassf6 UTSW 5 90606805 missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90609787 missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90604366 critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90606840 missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90604118 missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90617768 missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90603877 missense probably damaging 1.00
R7038:Rassf6 UTSW 5 90609725 missense probably benign 0.13
R7190:Rassf6 UTSW 5 90606807 missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90606802 missense probably damaging 1.00
RF002:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF002:Rassf6 UTSW 5 90608925 nonsense probably null
RF004:Rassf6 UTSW 5 90608919 utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90608941 utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608912 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608917 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90608908 utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608930 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608932 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90608913 utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608916 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608911 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608931 utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90608942 nonsense probably null
X0017:Rassf6 UTSW 5 90606789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACACTACCAGGCTTCTCG -3'
(R):5'- CGCTGCATTTCAGGATATAGCTG -3'

Sequencing Primer
(F):5'- TACCAGGCTTCTCGGCGAC -3'
(R):5'- TTTGCCCAAAAACATACAGGGTGTG -3'
Posted On2018-08-29