Incidental Mutation 'R6746:Anpep'
ID 532835
Institutional Source Beutler Lab
Gene Symbol Anpep
Ensembl Gene ENSMUSG00000039062
Gene Name alanyl (membrane) aminopeptidase
Synonyms aminopeptidase N, Cd13, Apn
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6746 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79821803-79861059 bp(-) (GRCm38)
Type of Mutation splice site (8960 bp from exon)
DNA Base Change (assembly) A to C at 79839185 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502] [ENSMUST00000206235]
AlphaFold P97449
Predicted Effect probably damaging
Transcript: ENSMUST00000049004
AA Change: I385S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: I385S

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 6.3e-142 PFAM
Pfam:Peptidase_MA_2 355 502 1.4e-21 PFAM
Pfam:ERAP1_C 618 944 2.9e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107392
AA Change: I385S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: I385S

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 2.5e-139 PFAM
Pfam:ERAP1_C 618 943 2e-73 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205502
Predicted Effect probably benign
Transcript: ENSMUST00000206235
Meta Mutation Damage Score 0.9657 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,346,221 L79* probably null Het
Acot3 A G 12: 84,053,474 N8S probably benign Het
Adora2a T C 10: 75,333,608 V302A probably benign Het
Arrb1 A G 7: 99,601,150 K392E probably benign Het
Atp8a1 A T 5: 67,751,049 N444K probably benign Het
Brinp2 C T 1: 158,266,590 G181R probably benign Het
Cacna1g A T 11: 94,409,427 C2184* probably null Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Ccdc155 C T 7: 45,200,311 V63I probably benign Het
Ccdc30 T C 4: 119,356,718 T205A probably benign Het
Celsr1 A G 15: 86,031,495 I759T probably damaging Het
Chaf1a A G 17: 56,063,404 D623G possibly damaging Het
Col6a3 G T 1: 90,779,045 N2115K unknown Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Erich6 T C 3: 58,616,566 D629G possibly damaging Het
Fahd1 G T 17: 24,849,941 A54E probably damaging Het
Flrt3 C T 2: 140,660,025 R561Q probably damaging Het
Gm5415 A T 1: 32,546,763 I22N probably benign Het
Grm6 A T 11: 50,856,963 D334V probably damaging Het
Helb A T 10: 120,105,468 D438E probably damaging Het
Hmgcs1 T C 13: 119,695,049 probably null Het
Hnf4g C A 3: 3,657,110 Y441* probably null Het
Hrasls5 A G 19: 7,613,330 D74G probably benign Het
Hspa13 A T 16: 75,765,037 N91K possibly damaging Het
Ilvbl T C 10: 78,577,223 I193T possibly damaging Het
Itga7 T C 10: 128,949,472 V848A probably benign Het
Lpin1 A G 12: 16,565,528 M341T probably benign Het
Lypd5 G T 7: 24,353,106 probably null Het
Mrgprb1 A C 7: 48,447,897 V89G possibly damaging Het
Nsun7 T C 5: 66,283,737 probably null Het
Oasl1 T A 5: 114,937,183 V434E probably damaging Het
Olfr1008 T C 2: 85,689,608 Y60H probably damaging Het
Olfr319 G A 11: 58,702,543 V281I probably benign Het
Olfr837 A G 9: 19,137,478 M162V probably benign Het
Otor T A 2: 143,080,035 probably null Het
Pik3cg G A 12: 32,194,758 T899M probably damaging Het
Pld2 C A 11: 70,541,107 L52M probably damaging Het
Pon3 A T 6: 5,230,786 M247K possibly damaging Het
Ppfia2 C A 10: 106,906,458 Y1037* probably null Het
Ppm1m A T 9: 106,198,152 C99* probably null Het
Prss44 A T 9: 110,815,293 *145C probably null Het
Ptpro T A 6: 137,394,823 Y613N probably damaging Het
Ralgapb T G 2: 158,476,136 V866G probably damaging Het
Rassf6 C A 5: 90,609,774 R109L possibly damaging Het
Rbm4b A C 19: 4,762,003 T147P probably benign Het
Rpl7l1 T C 17: 46,779,396 K104R probably benign Het
Ryr1 A T 7: 29,117,404 I69N possibly damaging Het
Scd1 G T 19: 44,406,488 F99L probably benign Het
Spint2 A T 7: 29,259,423 S66T probably benign Het
Tarm1 T A 7: 3,502,462 I2F probably benign Het
Tenm4 T C 7: 96,892,860 V1860A probably damaging Het
Uhrf1bp1l T A 10: 89,787,158 N298K probably benign Het
Usp38 A G 8: 81,014,291 I49T possibly damaging Het
Vars2 A G 17: 35,660,402 probably null Het
Vmn2r27 T G 6: 124,200,593 H484P possibly damaging Het
Wdr35 T A 12: 9,003,982 probably null Het
Zfp937 A T 2: 150,239,423 K458* probably null Het
Other mutations in Anpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Anpep APN 7 79825736 missense possibly damaging 0.64
IGL00089:Anpep APN 7 79841986 missense probably damaging 1.00
IGL00767:Anpep APN 7 79840890 missense probably benign 0.00
IGL00901:Anpep APN 7 79839423 missense probably benign
IGL01919:Anpep APN 7 79825350 missense possibly damaging 0.77
IGL02049:Anpep APN 7 79835181 missense probably damaging 0.97
IGL02195:Anpep APN 7 79826685 missense probably damaging 1.00
IGL02210:Anpep APN 7 79826904 missense probably benign 0.00
IGL02584:Anpep APN 7 79825393 splice site probably benign
IGL02677:Anpep APN 7 79838730 missense probably damaging 1.00
IGL03073:Anpep APN 7 79838955 missense probably damaging 1.00
IGL03100:Anpep APN 7 79836361 missense probably benign 0.01
PIT4696001:Anpep UTSW 7 79839464 missense possibly damaging 0.85
R0329:Anpep UTSW 7 79838256 missense probably benign 0.01
R0330:Anpep UTSW 7 79838256 missense probably benign 0.01
R0619:Anpep UTSW 7 79841009 missense probably benign
R0691:Anpep UTSW 7 79839299 missense probably damaging 0.98
R1004:Anpep UTSW 7 79838256 missense probably benign 0.01
R1005:Anpep UTSW 7 79838256 missense probably benign 0.01
R1274:Anpep UTSW 7 79838256 missense probably benign 0.01
R1288:Anpep UTSW 7 79838256 missense probably benign 0.01
R1289:Anpep UTSW 7 79838256 missense probably benign 0.01
R1532:Anpep UTSW 7 79826948 nonsense probably null
R1540:Anpep UTSW 7 79838256 missense probably benign 0.01
R1574:Anpep UTSW 7 79838407 splice site probably null
R1574:Anpep UTSW 7 79838407 splice site probably null
R1618:Anpep UTSW 7 79835417 missense probably benign 0.00
R1627:Anpep UTSW 7 79842011 missense probably benign
R1693:Anpep UTSW 7 79838256 missense probably benign 0.01
R1717:Anpep UTSW 7 79838256 missense probably benign 0.01
R1745:Anpep UTSW 7 79838256 missense probably benign 0.01
R1746:Anpep UTSW 7 79838256 missense probably benign 0.01
R1748:Anpep UTSW 7 79838256 missense probably benign 0.01
R1809:Anpep UTSW 7 79841823 missense probably benign 0.01
R1901:Anpep UTSW 7 79838256 missense probably benign 0.01
R1902:Anpep UTSW 7 79838256 missense probably benign 0.01
R1903:Anpep UTSW 7 79838256 missense probably benign 0.01
R1985:Anpep UTSW 7 79840857 splice site probably null
R2379:Anpep UTSW 7 79841218 missense probably benign 0.28
R2508:Anpep UTSW 7 79838291 missense possibly damaging 0.80
R3110:Anpep UTSW 7 79841972 missense probably benign 0.15
R3112:Anpep UTSW 7 79841972 missense probably benign 0.15
R3898:Anpep UTSW 7 79839225 missense probably benign 0.07
R3899:Anpep UTSW 7 79839225 missense probably benign 0.07
R3900:Anpep UTSW 7 79839225 missense probably benign 0.07
R4211:Anpep UTSW 7 79840996 nonsense probably null
R4701:Anpep UTSW 7 79839465 missense probably benign 0.16
R4716:Anpep UTSW 7 79826632 missense probably benign 0.00
R5020:Anpep UTSW 7 79833727 missense probably benign
R5042:Anpep UTSW 7 79839469 missense probably benign 0.00
R5084:Anpep UTSW 7 79826870 critical splice donor site probably null
R5319:Anpep UTSW 7 79841731 missense probably benign
R5593:Anpep UTSW 7 79842046 missense probably benign 0.04
R5778:Anpep UTSW 7 79836391 missense probably benign 0.00
R5852:Anpep UTSW 7 79838972 nonsense probably null
R5906:Anpep UTSW 7 79833675 missense probably benign
R6164:Anpep UTSW 7 79842205 missense possibly damaging 0.68
R6254:Anpep UTSW 7 79839233 missense probably damaging 1.00
R6284:Anpep UTSW 7 79825802 missense probably damaging 1.00
R6380:Anpep UTSW 7 79841896 missense probably benign 0.04
R6594:Anpep UTSW 7 79841361 splice site probably null
R6920:Anpep UTSW 7 79825349 missense probably damaging 1.00
R7060:Anpep UTSW 7 79841794 missense probably benign 0.33
R7072:Anpep UTSW 7 79835379 missense possibly damaging 0.58
R7095:Anpep UTSW 7 79842202 missense possibly damaging 0.87
R7102:Anpep UTSW 7 79836313 missense probably benign 0.00
R7178:Anpep UTSW 7 79840988 missense probably benign
R7223:Anpep UTSW 7 79825310 missense probably damaging 1.00
R7344:Anpep UTSW 7 79838650 missense possibly damaging 0.60
R7441:Anpep UTSW 7 79827644 missense possibly damaging 0.93
R7479:Anpep UTSW 7 79835370 missense probably benign 0.11
R7503:Anpep UTSW 7 79826637 missense probably damaging 1.00
R7683:Anpep UTSW 7 79839198 missense probably damaging 0.98
R7912:Anpep UTSW 7 79838426 missense probably benign 0.00
R7935:Anpep UTSW 7 79826961 missense possibly damaging 0.46
R8036:Anpep UTSW 7 79841898 missense probably benign 0.11
R8039:Anpep UTSW 7 79839400 critical splice donor site probably null
R8470:Anpep UTSW 7 79839521 missense probably benign 0.16
R8549:Anpep UTSW 7 79840896 missense probably benign 0.00
R8723:Anpep UTSW 7 79838938 missense probably damaging 1.00
R8726:Anpep UTSW 7 79840893 missense probably benign 0.00
R9042:Anpep UTSW 7 79838762 missense probably damaging 0.99
R9151:Anpep UTSW 7 79842037 missense probably benign 0.31
R9200:Anpep UTSW 7 79841122 missense probably benign 0.00
R9216:Anpep UTSW 7 79836301 missense possibly damaging 0.49
R9570:Anpep UTSW 7 79826913 missense probably benign 0.00
R9769:Anpep UTSW 7 79838730 missense probably damaging 1.00
Z1176:Anpep UTSW 7 79827639 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAGCCACAGTCACCAGGTTG -3'
(R):5'- TACATGGAGGTAGTGCCAGG -3'

Sequencing Primer
(F):5'- GTTGCCAAACCACTGCAGG -3'
(R):5'- TAGTGCCAGGATGCCCATTCAG -3'
Posted On 2018-08-29