Incidental Mutation 'R6746:Ppm1m'
ID 532840
Institutional Source Beutler Lab
Gene Symbol Ppm1m
Ensembl Gene ENSMUSG00000020253
Gene Name protein phosphatase 1M
Synonyms 2810423O19Rik, PP2C eta
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_026447.4, NM_198931.3; MGI:1915155

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6746 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 106194947-106199746 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 106198152 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 99 (C99*)
Ref Sequence ENSEMBL: ENSMUSP00000117908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024047] [ENSMUST00000076258] [ENSMUST00000140761] [ENSMUST00000187647] [ENSMUST00000187944] [ENSMUST00000216348]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024047
SMART Domains Protein: ENSMUSP00000024047
Gene: ENSMUSG00000023277

DomainStartEndE-ValueType
ADF 11 139 4.24e-23 SMART
ADF 184 313 1.51e-19 SMART
low complexity region 325 337 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000076258
AA Change: C43*
SMART Domains Protein: ENSMUSP00000075607
Gene: ENSMUSG00000020253
AA Change: C43*

DomainStartEndE-ValueType
PP2Cc 14 394 7.38e-44 SMART
PP2C_SIG 50 396 1.51e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136431
SMART Domains Protein: ENSMUSP00000118165
Gene: ENSMUSG00000020253

DomainStartEndE-ValueType
PP2Cc 2 200 1.93e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140761
AA Change: C99*
SMART Domains Protein: ENSMUSP00000117908
Gene: ENSMUSG00000020253
AA Change: C99*

DomainStartEndE-ValueType
PP2Cc 60 450 8.04e-45 SMART
PP2C_SIG 106 452 1.51e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187647
SMART Domains Protein: ENSMUSP00000140617
Gene: ENSMUSG00000023277

DomainStartEndE-ValueType
SCOP:d1f7sa_ 5 34 5e-4 SMART
PDB:2VAC|A 6 44 1e-12 PDB
Blast:ADF 11 48 6e-8 BLAST
low complexity region 56 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187944
Predicted Effect unknown
Transcript: ENSMUST00000213197
AA Change: V70E
Predicted Effect probably benign
Transcript: ENSMUST00000215742
Predicted Effect probably benign
Transcript: ENSMUST00000216348
Meta Mutation Damage Score 0.9060 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 100% (58/58)
Allele List at MGI

All alleles(8) : Targeted(2) Gene trapped(6)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,346,221 L79* probably null Het
Acot3 A G 12: 84,053,474 N8S probably benign Het
Adora2a T C 10: 75,333,608 V302A probably benign Het
Anpep A C 7: 79,839,185 probably null Het
Arrb1 A G 7: 99,601,150 K392E probably benign Het
Atp8a1 A T 5: 67,751,049 N444K probably benign Het
Brinp2 C T 1: 158,266,590 G181R probably benign Het
Cacna1g A T 11: 94,409,427 C2184* probably null Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Ccdc155 C T 7: 45,200,311 V63I probably benign Het
Ccdc30 T C 4: 119,356,718 T205A probably benign Het
Celsr1 A G 15: 86,031,495 I759T probably damaging Het
Chaf1a A G 17: 56,063,404 D623G possibly damaging Het
Col6a3 G T 1: 90,779,045 N2115K unknown Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Erich6 T C 3: 58,616,566 D629G possibly damaging Het
Fahd1 G T 17: 24,849,941 A54E probably damaging Het
Flrt3 C T 2: 140,660,025 R561Q probably damaging Het
Gm5415 A T 1: 32,546,763 I22N probably benign Het
Grm6 A T 11: 50,856,963 D334V probably damaging Het
Helb A T 10: 120,105,468 D438E probably damaging Het
Hmgcs1 T C 13: 119,695,049 probably null Het
Hnf4g C A 3: 3,657,110 Y441* probably null Het
Hrasls5 A G 19: 7,613,330 D74G probably benign Het
Hspa13 A T 16: 75,765,037 N91K possibly damaging Het
Ilvbl T C 10: 78,577,223 I193T possibly damaging Het
Itga7 T C 10: 128,949,472 V848A probably benign Het
Lpin1 A G 12: 16,565,528 M341T probably benign Het
Lypd5 G T 7: 24,353,106 probably null Het
Mrgprb1 A C 7: 48,447,897 V89G possibly damaging Het
Nsun7 T C 5: 66,283,737 probably null Het
Oasl1 T A 5: 114,937,183 V434E probably damaging Het
Olfr1008 T C 2: 85,689,608 Y60H probably damaging Het
Olfr319 G A 11: 58,702,543 V281I probably benign Het
Olfr837 A G 9: 19,137,478 M162V probably benign Het
Otor T A 2: 143,080,035 probably null Het
Pik3cg G A 12: 32,194,758 T899M probably damaging Het
Pld2 C A 11: 70,541,107 L52M probably damaging Het
Pon3 A T 6: 5,230,786 M247K possibly damaging Het
Ppfia2 C A 10: 106,906,458 Y1037* probably null Het
Prss44 A T 9: 110,815,293 *145C probably null Het
Ptpro T A 6: 137,394,823 Y613N probably damaging Het
Ralgapb T G 2: 158,476,136 V866G probably damaging Het
Rassf6 C A 5: 90,609,774 R109L possibly damaging Het
Rbm4b A C 19: 4,762,003 T147P probably benign Het
Rpl7l1 T C 17: 46,779,396 K104R probably benign Het
Ryr1 A T 7: 29,117,404 I69N possibly damaging Het
Scd1 G T 19: 44,406,488 F99L probably benign Het
Spint2 A T 7: 29,259,423 S66T probably benign Het
Tarm1 T A 7: 3,502,462 I2F probably benign Het
Tenm4 T C 7: 96,892,860 V1860A probably damaging Het
Uhrf1bp1l T A 10: 89,787,158 N298K probably benign Het
Usp38 A G 8: 81,014,291 I49T possibly damaging Het
Vars2 A G 17: 35,660,402 probably null Het
Vmn2r27 T G 6: 124,200,593 H484P possibly damaging Het
Wdr35 T A 12: 9,003,982 probably null Het
Zfp937 A T 2: 150,239,423 K458* probably null Het
Other mutations in Ppm1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Ppm1m APN 9 106199157 missense probably damaging 0.96
IGL02090:Ppm1m APN 9 106196802 critical splice donor site probably null
IGL02644:Ppm1m APN 9 106196883 missense probably damaging 1.00
IGL02691:Ppm1m APN 9 106195369 missense probably damaging 1.00
IGL03094:Ppm1m APN 9 106196411 missense probably damaging 1.00
R0047:Ppm1m UTSW 9 106196696 nonsense probably null
R0047:Ppm1m UTSW 9 106196696 nonsense probably null
R0361:Ppm1m UTSW 9 106198126 missense probably damaging 1.00
R0452:Ppm1m UTSW 9 106197302 missense probably damaging 1.00
R3053:Ppm1m UTSW 9 106198675 missense probably benign
R4654:Ppm1m UTSW 9 106196402 missense probably damaging 1.00
R5121:Ppm1m UTSW 9 106195805 missense probably benign 0.03
R5450:Ppm1m UTSW 9 106196842 missense probably benign 0.02
R5516:Ppm1m UTSW 9 106197939 missense probably damaging 0.98
R6278:Ppm1m UTSW 9 106197228 missense probably damaging 1.00
R6533:Ppm1m UTSW 9 106196870 unclassified probably benign
R7466:Ppm1m UTSW 9 106196157 missense probably damaging 0.99
R7486:Ppm1m UTSW 9 106196611 missense probably damaging 1.00
R7892:Ppm1m UTSW 9 106198696 missense probably benign
R7936:Ppm1m UTSW 9 106197945 missense probably damaging 1.00
R8815:Ppm1m UTSW 9 106199038 unclassified probably benign
R9643:Ppm1m UTSW 9 106197905 missense probably damaging 1.00
X0022:Ppm1m UTSW 9 106198122 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCAAGATAGCTGCAGCAG -3'
(R):5'- AGTTGTCCAAGTGTGTCAGG -3'

Sequencing Primer
(F):5'- TCAAACAGTGCCCAGTAGTG -3'
(R):5'- CAAGTGTGTCAGGGCGCAG -3'
Posted On 2018-08-29