Incidental Mutation 'R6746:Wdr35'
ID532851
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene NameWD repeat domain 35
Synonyms4930459M12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6746 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location8973892-9028847 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 9003982 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085745] [ENSMUST00000111113]
Predicted Effect probably null
Transcript: ENSMUST00000085745
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111113
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,346,221 L79* probably null Het
Acot3 A G 12: 84,053,474 N8S probably benign Het
Adora2a T C 10: 75,333,608 V302A probably benign Het
Anpep A C 7: 79,839,185 probably null Het
Arrb1 A G 7: 99,601,150 K392E probably benign Het
Atp8a1 A T 5: 67,751,049 N444K probably benign Het
Brinp2 C T 1: 158,266,590 G181R probably benign Het
Cacna1g A T 11: 94,409,427 C2184* probably null Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Ccdc155 C T 7: 45,200,311 V63I probably benign Het
Ccdc30 T C 4: 119,356,718 T205A probably benign Het
Celsr1 A G 15: 86,031,495 I759T probably damaging Het
Chaf1a A G 17: 56,063,404 D623G possibly damaging Het
Col6a3 G T 1: 90,779,045 N2115K unknown Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Erich6 T C 3: 58,616,566 D629G possibly damaging Het
Fahd1 G T 17: 24,849,941 A54E probably damaging Het
Flrt3 C T 2: 140,660,025 R561Q probably damaging Het
Gm5415 A T 1: 32,546,763 I22N probably benign Het
Grm6 A T 11: 50,856,963 D334V probably damaging Het
Helb A T 10: 120,105,468 D438E probably damaging Het
Hmgcs1 T C 13: 119,695,049 probably null Het
Hnf4g C A 3: 3,657,110 Y441* probably null Het
Hrasls5 A G 19: 7,613,330 D74G probably benign Het
Hspa13 A T 16: 75,765,037 N91K possibly damaging Het
Ilvbl T C 10: 78,577,223 I193T possibly damaging Het
Itga7 T C 10: 128,949,472 V848A probably benign Het
Lpin1 A G 12: 16,565,528 M341T probably benign Het
Lypd5 G T 7: 24,353,106 probably null Het
Mrgprb1 A C 7: 48,447,897 V89G possibly damaging Het
Nsun7 T C 5: 66,283,737 probably null Het
Oasl1 T A 5: 114,937,183 V434E probably damaging Het
Olfr1008 T C 2: 85,689,608 Y60H probably damaging Het
Olfr319 G A 11: 58,702,543 V281I probably benign Het
Olfr837 A G 9: 19,137,478 M162V probably benign Het
Otor T A 2: 143,080,035 probably null Het
Pik3cg G A 12: 32,194,758 T899M probably damaging Het
Pld2 C A 11: 70,541,107 L52M probably damaging Het
Pon3 A T 6: 5,230,786 M247K possibly damaging Het
Ppfia2 C A 10: 106,906,458 Y1037* probably null Het
Ppm1m A T 9: 106,198,152 C99* probably null Het
Prss44 A T 9: 110,815,293 *145C probably null Het
Ptpro T A 6: 137,394,823 Y613N probably damaging Het
Ralgapb T G 2: 158,476,136 V866G probably damaging Het
Rassf6 C A 5: 90,609,774 R109L possibly damaging Het
Rbm4b A C 19: 4,762,003 T147P probably benign Het
Rpl7l1 T C 17: 46,779,396 K104R probably benign Het
Ryr1 A T 7: 29,117,404 I69N possibly damaging Het
Scd1 G T 19: 44,406,488 F99L probably benign Het
Spint2 A T 7: 29,259,423 S66T probably benign Het
Tarm1 T A 7: 3,502,462 I2F probably benign Het
Tenm4 T C 7: 96,892,860 V1860A probably damaging Het
Uhrf1bp1l T A 10: 89,787,158 N298K probably benign Het
Usp38 A G 8: 81,014,291 I49T possibly damaging Het
Vars2 A G 17: 35,660,402 probably null Het
Vmn2r27 T G 6: 124,200,593 H484P possibly damaging Het
Zfp937 A T 2: 150,239,423 K458* probably null Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R7857:Wdr35 UTSW 12 9008113 critical splice donor site probably null
R8289:Wdr35 UTSW 12 9008020 missense probably benign 0.00
R8302:Wdr35 UTSW 12 9028110 missense probably benign 0.09
R8433:Wdr35 UTSW 12 9008495 missense probably damaging 1.00
R8479:Wdr35 UTSW 12 8985985 missense probably benign 0.04
R8498:Wdr35 UTSW 12 9008626 missense probably damaging 0.97
R8721:Wdr35 UTSW 12 9025044 critical splice donor site probably null
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTTGATCCTTGTACATCGCAG -3'
(R):5'- TGTCTGGATCCAATACGGTATAG -3'

Sequencing Primer
(F):5'- GCCTGATTTGAGAGACTGT -3'
(R):5'- GCTTCTTTGCCACACGAT -3'
Posted On2018-08-29