Mutagenetix > Incidental Mutations

Incidental Mutation 'R6746:Abca17'

532859

Institutional Source

Beutler Lab

Gene Symbol

Abca17

Ensembl Gene

ENSMUSG00000035435

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 17

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6746 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24264259-24351029 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 24346221 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 79 (L79*)

Ref Sequence

ENSEMBL: ENSMUSP00000112538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]

AlphaFold

E9PX95

Predicted Effect

probably null
Transcript: ENSMUST00000039324
AA Change: L79*

SMART Domains

Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: L79*

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
transmembrane domain	22	44	N/A	INTRINSIC
Pfam:ABC2_membrane_3	252	464	9.5e-17	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	6.7e-35	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000121226
AA Change: L79*

SMART Domains

Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: L79*

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
Pfam:ABC2_membrane_3	21	464	1.2e-15	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	1.1e-32	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

100% (58/58)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot3	A	G	12: 84,053,474	N8S	probably benign	Het
Adora2a	T	C	10: 75,333,608	V302A	probably benign	Het
Anpep	A	C	7: 79,839,185		probably null	Het
Arrb1	A	G	7: 99,601,150	K392E	probably benign	Het
Atp8a1	A	T	5: 67,751,049	N444K	probably benign	Het
Brinp2	C	T	1: 158,266,590	G181R	probably benign	Het
Cacna1g	A	T	11: 94,409,427	C2184*	probably null	Het
Cacna1h	C	T	17: 25,381,550	A1606T	probably damaging	Het
Ccdc155	C	T	7: 45,200,311	V63I	probably benign	Het
Ccdc30	T	C	4: 119,356,718	T205A	probably benign	Het
Celsr1	A	G	15: 86,031,495	I759T	probably damaging	Het
Chaf1a	A	G	17: 56,063,404	D623G	possibly damaging	Het
Col6a3	G	T	1: 90,779,045	N2115K	unknown	Het
Dync1h1	A	T	12: 110,651,653	T3209S	probably damaging	Het
Erich6	T	C	3: 58,616,566	D629G	possibly damaging	Het
Fahd1	G	T	17: 24,849,941	A54E	probably damaging	Het
Flrt3	C	T	2: 140,660,025	R561Q	probably damaging	Het
Gm5415	A	T	1: 32,546,763	I22N	probably benign	Het
Grm6	A	T	11: 50,856,963	D334V	probably damaging	Het
Helb	A	T	10: 120,105,468	D438E	probably damaging	Het
Hmgcs1	T	C	13: 119,695,049		probably null	Het
Hnf4g	C	A	3: 3,657,110	Y441*	probably null	Het
Hrasls5	A	G	19: 7,613,330	D74G	probably benign	Het
Hspa13	A	T	16: 75,765,037	N91K	possibly damaging	Het
Ilvbl	T	C	10: 78,577,223	I193T	possibly damaging	Het
Itga7	T	C	10: 128,949,472	V848A	probably benign	Het
Lpin1	A	G	12: 16,565,528	M341T	probably benign	Het
Lypd5	G	T	7: 24,353,106		probably null	Het
Mrgprb1	A	C	7: 48,447,897	V89G	possibly damaging	Het
Nsun7	T	C	5: 66,283,737		probably null	Het
Oasl1	T	A	5: 114,937,183	V434E	probably damaging	Het
Olfr1008	T	C	2: 85,689,608	Y60H	probably damaging	Het
Olfr319	G	A	11: 58,702,543	V281I	probably benign	Het
Olfr837	A	G	9: 19,137,478	M162V	probably benign	Het
Otor	T	A	2: 143,080,035		probably null	Het
Pik3cg	G	A	12: 32,194,758	T899M	probably damaging	Het
Pld2	C	A	11: 70,541,107	L52M	probably damaging	Het
Pon3	A	T	6: 5,230,786	M247K	possibly damaging	Het
Ppfia2	C	A	10: 106,906,458	Y1037*	probably null	Het
Ppm1m	A	T	9: 106,198,152	C99*	probably null	Het
Prss44	A	T	9: 110,815,293	*145C	probably null	Het
Ptpro	T	A	6: 137,394,823	Y613N	probably damaging	Het
Ralgapb	T	G	2: 158,476,136	V866G	probably damaging	Het
Rassf6	C	A	5: 90,609,774	R109L	possibly damaging	Het
Rbm4b	A	C	19: 4,762,003	T147P	probably benign	Het
Rpl7l1	T	C	17: 46,779,396	K104R	probably benign	Het
Ryr1	A	T	7: 29,117,404	I69N	possibly damaging	Het
Scd1	G	T	19: 44,406,488	F99L	probably benign	Het
Spint2	A	T	7: 29,259,423	S66T	probably benign	Het
Tarm1	T	A	7: 3,502,462	I2F	probably benign	Het
Tenm4	T	C	7: 96,892,860	V1860A	probably damaging	Het
Uhrf1bp1l	T	A	10: 89,787,158	N298K	probably benign	Het
Usp38	A	G	8: 81,014,291	I49T	possibly damaging	Het
Vars2	A	G	17: 35,660,402		probably null	Het
Vmn2r27	T	G	6: 124,200,593	H484P	possibly damaging	Het
Wdr35	T	A	12: 9,003,982		probably null	Het
Zfp937	A	T	2: 150,239,423	K458*	probably null	Het

Other mutations in Abca17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca17	APN	17	24295191	missense	probably benign	0.14
IGL00585:Abca17	APN	17	24300320	missense	probably damaging	0.99
IGL00941:Abca17	APN	17	24317130	missense	probably damaging	1.00
IGL01987:Abca17	APN	17	24346228	missense	probably benign	0.00
IGL01988:Abca17	APN	17	24334255	missense	probably damaging	0.99
IGL02223:Abca17	APN	17	24287935	nonsense	probably null
IGL02368:Abca17	APN	17	24287793	missense	probably benign	0.01
IGL02405:Abca17	APN	17	24279062	missense	possibly damaging	0.80
IGL02431:Abca17	APN	17	24298984	missense	probably benign	0.05
IGL02607:Abca17	APN	17	24327705	nonsense	probably null
IGL02706:Abca17	APN	17	24298992	missense	probably benign	0.00
IGL02729:Abca17	APN	17	24280481	missense	probably benign	0.06
IGL02818:Abca17	APN	17	24300352	missense	probably benign	0.02
IGL02891:Abca17	APN	17	24281366	missense	probably damaging	0.99
IGL03236:Abca17	APN	17	24326476	splice site	probably benign
IGL03299:Abca17	APN	17	24265591	missense	probably damaging	1.00
basin	UTSW	17	24318185	missense	probably benign	0.01
Bowl	UTSW	17	24317238	missense	probably benign	0.09
R0018:Abca17	UTSW	17	24313188	splice site	probably null
R0467:Abca17	UTSW	17	24313177	splice site	probably benign
R0671:Abca17	UTSW	17	24281249	missense	probably benign	0.00
R1175:Abca17	UTSW	17	24289351	missense	possibly damaging	0.91
R1397:Abca17	UTSW	17	24285759	missense	probably benign	0.18
R1398:Abca17	UTSW	17	24328537	missense	probably damaging	0.96
R1678:Abca17	UTSW	17	24335620	missense	probably benign	0.05
R1696:Abca17	UTSW	17	24267658	missense	possibly damaging	0.90
R1781:Abca17	UTSW	17	24267557	missense	possibly damaging	0.95
R1845:Abca17	UTSW	17	24267716	missense	probably damaging	1.00
R1970:Abca17	UTSW	17	24307575	missense	probably benign	0.00
R1997:Abca17	UTSW	17	24285726	missense	probably benign	0.02
R2141:Abca17	UTSW	17	24334266	missense	probably benign	0.00
R2199:Abca17	UTSW	17	24335624	missense	probably benign	0.19
R2394:Abca17	UTSW	17	24281216	splice site	probably null
R2442:Abca17	UTSW	17	24328632	missense	probably benign	0.02
R2509:Abca17	UTSW	17	24289613	splice site	probably benign
R2848:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2849:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2859:Abca17	UTSW	17	24281314	missense	possibly damaging	0.46
R2879:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2935:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3153:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3154:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3434:Abca17	UTSW	17	24289537	missense	probably damaging	1.00
R3695:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3905:Abca17	UTSW	17	24296283	missense	probably benign	0.13
R4282:Abca17	UTSW	17	24299060	missense	possibly damaging	0.49
R4334:Abca17	UTSW	17	24318268	missense	probably damaging	1.00
R4350:Abca17	UTSW	17	24279046	critical splice donor site	probably null
R4548:Abca17	UTSW	17	24334271	missense	possibly damaging	0.82
R4626:Abca17	UTSW	17	24321084	missense	probably damaging	1.00
R4722:Abca17	UTSW	17	24265429	missense	probably damaging	1.00
R4745:Abca17	UTSW	17	24307453	missense	probably damaging	1.00
R4818:Abca17	UTSW	17	24317161	missense	probably damaging	0.98
R5279:Abca17	UTSW	17	24289414	missense	probably damaging	1.00
R5310:Abca17	UTSW	17	24281230	missense	probably benign	0.00
R5320:Abca17	UTSW	17	24307567	missense	probably damaging	1.00
R5435:Abca17	UTSW	17	24267614	missense	possibly damaging	0.90
R5622:Abca17	UTSW	17	24327668	missense	probably benign	0.14
R5776:Abca17	UTSW	17	24295158	missense	probably benign	0.09
R5928:Abca17	UTSW	17	24318185	missense	probably benign	0.01
R6013:Abca17	UTSW	17	24287846	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6052:Abca17	UTSW	17	24318191	missense	probably benign	0.00
R6063:Abca17	UTSW	17	24264344	missense	unknown
R6404:Abca17	UTSW	17	24265918	missense	probably benign	0.13
R6819:Abca17	UTSW	17	24287793	missense	probably benign	0.01
R6828:Abca17	UTSW	17	24326415	missense	possibly damaging	0.91
R7043:Abca17	UTSW	17	24265500	missense	probably damaging	1.00
R7065:Abca17	UTSW	17	24327751	missense	probably damaging	1.00
R7123:Abca17	UTSW	17	24265975	missense	probably damaging	1.00
R7157:Abca17	UTSW	17	24335590	missense	possibly damaging	0.46
R7188:Abca17	UTSW	17	24335626	missense	possibly damaging	0.89
R7294:Abca17	UTSW	17	24321009	missense	not run
R7352:Abca17	UTSW	17	24289054	nonsense	probably null
R7355:Abca17	UTSW	17	24267647	missense	probably benign	0.00
R7358:Abca17	UTSW	17	24291555	missense	probably benign	0.00
R7411:Abca17	UTSW	17	24328569	missense	possibly damaging	0.52
R7915:Abca17	UTSW	17	24265533	missense	probably damaging	1.00
R8039:Abca17	UTSW	17	24328725	missense	probably damaging	1.00
R8095:Abca17	UTSW	17	24317222	missense	possibly damaging	0.77
R8308:Abca17	UTSW	17	24267683	missense	probably damaging	1.00
R8517:Abca17	UTSW	17	24317233	missense	probably benign	0.00
R8811:Abca17	UTSW	17	24317238	missense	probably benign	0.09
R8819:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8820:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8953:Abca17	UTSW	17	24299041	missense	probably benign
R9095:Abca17	UTSW	17	24281396	missense	probably damaging	0.97
R9313:Abca17	UTSW	17	24346233	missense	probably benign	0.00
R9314:Abca17	UTSW	17	24328619	missense	possibly damaging	0.91
R9347:Abca17	UTSW	17	24264505	missense	probably benign
R9351:Abca17	UTSW	17	24291777	missense	probably benign	0.00
R9387:Abca17	UTSW	17	24334281	missense	probably benign	0.02
R9388:Abca17	UTSW	17	24264299	missense	unknown
RF024:Abca17	UTSW	17	24287732	frame shift	probably null
RF029:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
RF032:Abca17	UTSW	17	24287727	frame shift	probably null
RF036:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
X0017:Abca17	UTSW	17	24317163	missense	probably benign	0.26
X0065:Abca17	UTSW	17	24334284	missense	probably damaging	1.00
Z1088:Abca17	UTSW	17	24279079	missense	probably damaging	0.96
Z1088:Abca17	UTSW	17	24279107	missense	probably benign	0.03
Z1088:Abca17	UTSW	17	24346219	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCCCGTACTCACATTCACGAG -3'
(R):5'- CACTTGCTAGGTAGATGGTTACAC -3'

Sequencing Primer
(F):5'- GATAGAAATGCCCACCCTA -3'
(R):5'- TCTGTTTTAGAGGCGGAAGAC -3'

Posted On

2018-08-29