Incidental Mutation 'R6749:Slc4a3'
ID532868
Institutional Source Beutler Lab
Gene Symbol Slc4a3
Ensembl Gene ENSMUSG00000006576
Gene Namesolute carrier family 4 (anion exchanger), member 3
SynonymsA930038D23Rik, Ae3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75546266-75562172 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 75554538 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 792 (R792*)
Ref Sequence ENSEMBL: ENSMUSP00000116747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027415] [ENSMUST00000124341] [ENSMUST00000154101]
Predicted Effect probably benign
Transcript: ENSMUST00000027415
SMART Domains Protein: ENSMUSP00000027415
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 128 161 N/A INTRINSIC
low complexity region 194 216 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
Pfam:Band_3_cyto 349 500 7.9e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124341
AA Change: R792*
SMART Domains Protein: ENSMUSP00000116747
Gene: ENSMUSG00000006576
AA Change: R792*

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 128 161 N/A INTRINSIC
low complexity region 194 216 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
Pfam:Band_3_cyto 349 618 2.9e-106 PFAM
low complexity region 629 639 N/A INTRINSIC
Pfam:HCO3_cotransp 674 1156 3.6e-203 PFAM
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132110
SMART Domains Protein: ENSMUSP00000119942
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
SCOP:d1hynp_ 4 72 9e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145258
SMART Domains Protein: ENSMUSP00000119860
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:Band_3_cyto 50 193 4.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154101
SMART Domains Protein: ENSMUSP00000116488
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
Pfam:Band_3_cyto 152 227 2e-32 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane anion exchange protein. The encoded protein has been found in brain, heart, kidney, small intestine, and lung. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for one knock-out allele show inner retina defects including selective ERG b-wave depression, optic nerve and retinal vessel anomalies, sheathing of retinal vessels and late onset photoreceptor death. Homozygotes for another knock-out allele are more sensitive to seizure-inducing agents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Slc4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Slc4a3 APN 1 75555083 missense probably damaging 1.00
IGL00979:Slc4a3 APN 1 75554247 missense probably damaging 1.00
IGL01488:Slc4a3 APN 1 75548876 missense probably benign 0.45
IGL01567:Slc4a3 APN 1 75550882 missense probably damaging 1.00
IGL03090:Slc4a3 APN 1 75555017 missense probably benign 0.00
IGL03135:Slc4a3 APN 1 75547935 unclassified probably benign
R0004:Slc4a3 UTSW 1 75557009 unclassified probably benign
R0479:Slc4a3 UTSW 1 75551828 unclassified probably benign
R0507:Slc4a3 UTSW 1 75556081 missense probably damaging 1.00
R0591:Slc4a3 UTSW 1 75549021 missense probably damaging 1.00
R0742:Slc4a3 UTSW 1 75556081 missense probably damaging 1.00
R1577:Slc4a3 UTSW 1 75550891 missense probably damaging 1.00
R1794:Slc4a3 UTSW 1 75557308 missense probably damaging 0.99
R1804:Slc4a3 UTSW 1 75551717 missense probably damaging 1.00
R1911:Slc4a3 UTSW 1 75553723 missense probably damaging 1.00
R1974:Slc4a3 UTSW 1 75552191 nonsense probably null
R2696:Slc4a3 UTSW 1 75555475 missense possibly damaging 0.46
R2995:Slc4a3 UTSW 1 75552662 nonsense probably null
R3962:Slc4a3 UTSW 1 75556754 missense probably damaging 0.99
R4025:Slc4a3 UTSW 1 75549041 missense probably damaging 1.00
R4824:Slc4a3 UTSW 1 75550623 missense possibly damaging 0.54
R4858:Slc4a3 UTSW 1 75555085 missense probably damaging 1.00
R5075:Slc4a3 UTSW 1 75557368 missense probably damaging 1.00
R5450:Slc4a3 UTSW 1 75552656 missense probably damaging 1.00
R5636:Slc4a3 UTSW 1 75554216 missense possibly damaging 0.82
R5728:Slc4a3 UTSW 1 75549840 missense probably benign 0.05
R5921:Slc4a3 UTSW 1 75557444 critical splice donor site probably null
R5969:Slc4a3 UTSW 1 75549979 missense probably damaging 0.98
R6272:Slc4a3 UTSW 1 75554697 critical splice donor site probably null
R6788:Slc4a3 UTSW 1 75551315 missense probably damaging 1.00
R7308:Slc4a3 UTSW 1 75557362 missense probably benign 0.00
R7487:Slc4a3 UTSW 1 75553377 missense probably benign 0.05
R7673:Slc4a3 UTSW 1 75557351 missense probably damaging 1.00
R8004:Slc4a3 UTSW 1 75549067 critical splice donor site probably null
R8084:Slc4a3 UTSW 1 75555945 missense probably benign 0.25
R8221:Slc4a3 UTSW 1 75552166 missense probably benign 0.02
Z1176:Slc4a3 UTSW 1 75554235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCTGTCCTCTTATCCTAGGC -3'
(R):5'- TTGGACACCACCACACCTTG -3'

Sequencing Primer
(F):5'- TGTCAGCCCCTTATCTGAGTG -3'
(R):5'- CACCTTGTAGAGCTTGTGAAACGTC -3'
Posted On2018-08-29