Incidental Mutation 'R6749:Cacfd1'
ID532870
Institutional Source Beutler Lab
Gene Symbol Cacfd1
Ensembl Gene ENSMUSG00000015488
Gene Namecalcium channel flower domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location27009926-27021089 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27018455 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 134 (Y134H)
Ref Sequence ENSEMBL: ENSMUSP00000109640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045702] [ENSMUST00000102890] [ENSMUST00000114003] [ENSMUST00000114004] [ENSMUST00000114005] [ENSMUST00000114006] [ENSMUST00000114007]
Predicted Effect probably benign
Transcript: ENSMUST00000045702
SMART Domains Protein: ENSMUSP00000049103
Gene: ENSMUSG00000036067

DomainStartEndE-ValueType
Pfam:MFS_1 37 439 4.1e-25 PFAM
Pfam:Sugar_tr 39 488 8.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102890
SMART Domains Protein: ENSMUSP00000099954
Gene: ENSMUSG00000036067

DomainStartEndE-ValueType
Pfam:MFS_1 37 382 5.3e-22 PFAM
Pfam:Sugar_tr 39 341 3.4e-61 PFAM
Pfam:Sugar_tr 337 434 1.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114003
AA Change: Y72H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109636
Gene: ENSMUSG00000015488
AA Change: Y72H

DomainStartEndE-ValueType
Cg6151-P 1 80 6.19e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114004
SMART Domains Protein: ENSMUSP00000109637
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 106 7.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114005
SMART Domains Protein: ENSMUSP00000109638
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 114 5.53e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114006
AA Change: Y134H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109639
Gene: ENSMUSG00000015488
AA Change: Y134H

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 142 2.87e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114007
AA Change: Y134H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109640
Gene: ENSMUSG00000015488
AA Change: Y134H

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 142 2.87e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133807
SMART Domains Protein: ENSMUSP00000122562
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
Cg6151-P 53 118 8.02e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to DMPA/TPA-induced papilloma formation (number and latency) associated with decreased cell proliferation and increased apoptosis of cells in papillomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Cacfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0751:Cacfd1 UTSW 2 27018981 critical splice donor site probably null
R1538:Cacfd1 UTSW 2 27018939 missense probably benign 0.43
R6017:Cacfd1 UTSW 2 27013428 intron probably benign
R6528:Cacfd1 UTSW 2 27018939 missense probably benign 0.43
R7334:Cacfd1 UTSW 2 27015546 missense possibly damaging 0.80
R7691:Cacfd1 UTSW 2 27010094 missense probably damaging 0.97
R8223:Cacfd1 UTSW 2 27018384 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGGGTCATAGATCTTGCCACAAAG -3'
(R):5'- TGCAATGTCTGGTGCATACC -3'

Sequencing Primer
(F):5'- GATCTGATACAGCTTTGGACTCTGAC -3'
(R):5'- GGTGCATACCTCACTGTGTATAAAC -3'
Posted On2018-08-29