Incidental Mutation 'R6749:Gata5'
ID532874
Institutional Source Beutler Lab
Gene Symbol Gata5
Ensembl Gene ENSMUSG00000015627
Gene NameGATA binding protein 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location180325133-180334699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180334350 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 7 (L7S)
Ref Sequence ENSEMBL: ENSMUSP00000015771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015771]
Predicted Effect probably damaging
Transcript: ENSMUST00000015771
AA Change: L7S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015771
Gene: ENSMUSG00000015627
AA Change: L7S

DomainStartEndE-ValueType
Pfam:GATA-N 1 181 4.4e-58 PFAM
ZnF_GATA 190 240 7.3e-20 SMART
ZnF_GATA 244 294 1.55e-23 SMART
low complexity region 309 323 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that contains two GATA-type zinc fingers. The encoded protein is known to bind to hepatocyte nuclear factor-1alpha (HNF-1alpha), and this interaction is essential for cooperative activation of the intestinal lactase-phlorizin hydrolase promoter. In other organisms, similar proteins may be involved in the establishment of cardiac smooth muscle cell diversity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for disruptions in this gene are viable and fertile and appear to be normal. Females, on the other hand, have abnormalities of the external genitalia, most apparently reduced distance between anus and vagina, and experience reduced fertility due to vaginal tract obstructions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Gata5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Gata5 APN 2 180327345 splice site probably benign
IGL01916:Gata5 APN 2 180326941 missense possibly damaging 0.95
IGL02662:Gata5 APN 2 180327751 splice site probably benign
E0354:Gata5 UTSW 2 180333965 frame shift probably null
R0562:Gata5 UTSW 2 180327759 critical splice donor site probably null
R1959:Gata5 UTSW 2 180326936 missense possibly damaging 0.61
R2296:Gata5 UTSW 2 180328320 missense possibly damaging 0.87
R2862:Gata5 UTSW 2 180334336 missense possibly damaging 0.87
R4697:Gata5 UTSW 2 180327379 nonsense probably null
R5301:Gata5 UTSW 2 180333993 missense probably damaging 0.96
R5583:Gata5 UTSW 2 180334254 missense probably benign 0.02
R7038:Gata5 UTSW 2 180333892 missense possibly damaging 0.92
R7635:Gata5 UTSW 2 180333997 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AATCAGCGGCAACTGCTTG -3'
(R):5'- TGTCATTCCACCCAGAGGAG -3'

Sequencing Primer
(F):5'- CAACTGCTTGTGTCCAGCTGG -3'
(R):5'- GACCTGCCCTGGTGAAC -3'
Posted On2018-08-29