Incidental Mutation 'R6749:Pmp2'
ID 532875
Institutional Source Beutler Lab
Gene Symbol Pmp2
Ensembl Gene ENSMUSG00000052468
Gene Name peripheral myelin protein 2
Synonyms P2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R6749 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 10179851-10183929 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10182482 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 49 (Y49C)
Ref Sequence ENSEMBL: ENSMUSP00000029034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029034] [ENSMUST00000194885]
AlphaFold P24526
Predicted Effect probably benign
Transcript: ENSMUST00000029034
AA Change: Y49C

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029034
Gene: ENSMUSG00000052468
AA Change: Y49C

DomainStartEndE-ValueType
Pfam:Lipocalin 6 132 2.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194885
SMART Domains Protein: ENSMUSP00000141340
Gene: ENSMUSG00000103124

DomainStartEndE-ValueType
Pfam:Lipocalin 16 94 8.7e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to myelin sheaths of the peripheral nervous system. The encoded protein can bind both the membrane layers of the sheaths and monomeric lipids, and is thought to provide stability to the sheath. A defect in this gene was shown to be a cause of dominant demyelinating CMT neuropathy. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a temporary reduction in motor nerve conduction velocity and transitory alterations in the lipid profile of peripheral myelin but no major defects in general PNS myelin structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Pmp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Pmp2 APN 3 10182481 nonsense probably null
IGL02367:Pmp2 APN 3 10182500 missense probably damaging 1.00
IGL02479:Pmp2 APN 3 10182202 missense probably benign 0.00
R0419:Pmp2 UTSW 3 10180763 missense probably damaging 1.00
R1754:Pmp2 UTSW 3 10182224 critical splice acceptor site probably null
R1943:Pmp2 UTSW 3 10182510 missense probably benign 0.01
R5141:Pmp2 UTSW 3 10182414 missense probably benign 0.02
R5647:Pmp2 UTSW 3 10183785 missense probably benign
R8789:Pmp2 UTSW 3 10182504 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCACATTCATTCCCCAGG -3'
(R):5'- GGCATCTGTCTCTTAGATATGCC -3'

Sequencing Primer
(F):5'- GTCCCTAACTCTGAGAAGGGATC -3'
(R):5'- TTAGATATGCCTCCTTAACCAACC -3'
Posted On 2018-08-29