Incidental Mutation 'R6749:Esrp1'
ID532878
Institutional Source Beutler Lab
Gene Symbol Esrp1
Ensembl Gene ENSMUSG00000040728
Gene Nameepithelial splicing regulatory protein 1
Synonyms2210008M09Rik, Rbm35a
MMRRC Submission
Accession Numbers

Genbank: NM_194055; MGI: 1917326

Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location11331933-11386783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11357519 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 366 (V366E)
Ref Sequence ENSEMBL: ENSMUSP00000121117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043781] [ENSMUST00000108310] [ENSMUST00000108311] [ENSMUST00000108313] [ENSMUST00000147342] [ENSMUST00000155519]
Predicted Effect probably damaging
Transcript: ENSMUST00000043781
AA Change: V531E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037921
Gene: ENSMUSG00000040728
AA Change: V531E

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108310
AA Change: V531E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103946
Gene: ENSMUSG00000040728
AA Change: V531E

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108311
AA Change: V531E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103947
Gene: ENSMUSG00000040728
AA Change: V531E

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108313
AA Change: V531E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103949
Gene: ENSMUSG00000040728
AA Change: V531E

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147342
AA Change: V366E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121117
Gene: ENSMUSG00000040728
AA Change: V366E

DomainStartEndE-ValueType
RRM 61 133 2.6e-2 SMART
RRM 162 237 1.75e-5 SMART
low complexity region 255 269 N/A INTRINSIC
RRM 281 356 1.03e-2 SMART
low complexity region 377 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155519
SMART Domains Protein: ENSMUSP00000119598
Gene: ENSMUSG00000040728

DomainStartEndE-ValueType
RRM 212 284 2.6e-2 SMART
RRM 313 388 1.75e-5 SMART
low complexity region 406 420 N/A INTRINSIC
Blast:RRM 432 472 7e-20 BLAST
Meta Mutation Damage Score 0.7654 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESPR1 is an epithelial cell-type-specific splicing regulator (Warzecha et al., 2009 [PubMed 19285943]).[supplied by OMIM, Aug 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit hyperactivity and circling with no detectable hearing deficits. Mice homozygous for a null allele exhibit bilateral cleft lip and cleft palate, and die at P0. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Esrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Esrp1 APN 4 11384374 missense possibly damaging 0.47
IGL02251:Esrp1 APN 4 11361202 missense probably damaging 1.00
IGL02669:Esrp1 APN 4 11386324 missense possibly damaging 0.61
Barley UTSW 4 11365205 missense probably damaging 1.00
korn UTSW 4 11357519 missense probably damaging 1.00
triaka UTSW 4 11379300 missense probably benign 0.01
R1109:Esrp1 UTSW 4 11365205 missense probably damaging 1.00
R1531:Esrp1 UTSW 4 11379375 missense probably damaging 0.99
R2189:Esrp1 UTSW 4 11357603 missense probably benign 0.04
R2255:Esrp1 UTSW 4 11365211 missense probably damaging 0.99
R5919:Esrp1 UTSW 4 11344146 missense probably damaging 0.96
R5924:Esrp1 UTSW 4 11361174 missense probably damaging 1.00
R6042:Esrp1 UTSW 4 11357580 missense possibly damaging 0.93
R6817:Esrp1 UTSW 4 11357552 missense probably damaging 1.00
R7392:Esrp1 UTSW 4 11338809 missense probably benign 0.00
R7607:Esrp1 UTSW 4 11384449 missense probably damaging 0.99
R8050:Esrp1 UTSW 4 11338767 missense probably damaging 1.00
Z1176:Esrp1 UTSW 4 11384396 missense probably damaging 1.00
Z1176:Esrp1 UTSW 4 11385765 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GATGAGTGTCCGCAACCAAG -3'
(R):5'- AGACAGTCGCCTTTTGTTTGTATTC -3'

Sequencing Primer
(F):5'- TCAGATGGGAAAGCCTTATGTACCC -3'
(R):5'- GTCGCCTTTTGTTTGTATTCTCCCC -3'
Posted On2018-08-29