Incidental Mutation 'R6749:Mmachc'
ID532880
Institutional Source Beutler Lab
Gene Symbol Mmachc
Ensembl Gene ENSMUSG00000028690
Gene Namemethylmalonic aciduria cblC type, with homocystinuria
Synonyms1810037K07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116702279-116708406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 116704541 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 132 (R132L)
Ref Sequence ENSEMBL: ENSMUSP00000030453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030452] [ENSMUST00000030453] [ENSMUST00000106462] [ENSMUST00000106463] [ENSMUST00000106464] [ENSMUST00000125671] [ENSMUST00000130828] [ENSMUST00000135499] [ENSMUST00000135573] [ENSMUST00000138305] [ENSMUST00000155391]
Predicted Effect probably benign
Transcript: ENSMUST00000030452
SMART Domains Protein: ENSMUSP00000030452
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
coiled coil region 112 144 N/A INTRINSIC
coiled coil region 165 196 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000030453
AA Change: R132L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030453
Gene: ENSMUSG00000028690
AA Change: R132L

DomainStartEndE-ValueType
Pfam:MMACHC 20 234 9.5e-102 PFAM
low complexity region 243 257 N/A INTRINSIC
low complexity region 268 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106462
SMART Domains Protein: ENSMUSP00000102070
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
coiled coil region 21 53 N/A INTRINSIC
coiled coil region 74 105 N/A INTRINSIC
low complexity region 171 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106463
SMART Domains Protein: ENSMUSP00000102071
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 138 170 N/A INTRINSIC
coiled coil region 191 222 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106464
SMART Domains Protein: ENSMUSP00000102072
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 138 170 N/A INTRINSIC
coiled coil region 191 222 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125671
SMART Domains Protein: ENSMUSP00000120954
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130828
SMART Domains Protein: ENSMUSP00000120572
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
coiled coil region 137 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135499
SMART Domains Protein: ENSMUSP00000114263
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135573
SMART Domains Protein: ENSMUSP00000114159
Gene: ENSMUSG00000028691

DomainStartEndE-ValueType
Pfam:Redoxin 7 158 3.8e-18 PFAM
Pfam:AhpC-TSA 8 142 2.8e-43 PFAM
Pfam:1-cysPrx_C 162 197 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138305
Predicted Effect probably benign
Transcript: ENSMUST00000155391
SMART Domains Protein: ENSMUSP00000120050
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
coiled coil region 137 169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of the protein encoded by this gene is not known, however, its C-terminal region shows similarity to TonB, a bacterial protein involved in energy transduction for cobalamin (vitamin B12) uptake. Hence, it is postulated that this protein may have a role in the binding and intracellular trafficking of cobalamin. Mutations in this gene are associated with methylmalonic aciduria and homocystinuria type cblC. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Camk1 G A 6: 113,334,525 P340L probably benign Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Mmachc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Mmachc APN 4 116705921 missense probably damaging 1.00
IGL02014:Mmachc APN 4 116703710 missense probably damaging 1.00
R0242:Mmachc UTSW 4 116704541 missense probably damaging 0.97
R0242:Mmachc UTSW 4 116704541 missense probably damaging 0.97
R0646:Mmachc UTSW 4 116703654 missense probably damaging 1.00
R1413:Mmachc UTSW 4 116705997 missense probably damaging 0.97
R1589:Mmachc UTSW 4 116703524 missense probably benign 0.05
R4037:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4038:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4039:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4627:Mmachc UTSW 4 116703471 missense probably damaging 0.97
R5557:Mmachc UTSW 4 116705900 missense probably damaging 0.96
R7541:Mmachc UTSW 4 116705885 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCATTCCATGCAGAAGGCTC -3'
(R):5'- GGACTTAGAACAAAATCATGACTCC -3'

Sequencing Primer
(F):5'- TGAAGGTCCTGAGTTCAAATCCCAG -3'
(R):5'- TGACTCCCATCATGCTAACAAG -3'
Posted On2018-08-29