Mutagenetix > Incidental Mutation

Incidental Mutation 'R6749:Padi3'

532881

Institutional Source

Beutler Lab

Gene Symbol

Padi3

Ensembl Gene

ENSMUSG00000025328

Gene Name

peptidyl arginine deiminase, type III

Synonyms

PAD type III, Pdi3, Pad3

MMRRC Submission

044866-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6749 (G1)

Quality Score

147.008

Status

Validated

Chromosome

Chromosomal Location

140785365-140810648 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140795853 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 289 (T289A)

Ref Sequence

ENSEMBL: ENSMUSP00000130721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026377] [ENSMUST00000172098]

AlphaFold

Q9Z184

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026377
AA Change: T299A

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000026377
Gene: ENSMUSG00000025328
AA Change: T299A

Domain	Start	End	E-Value	Type
Pfam:PAD_N	1	113	2.1e-38	PFAM
Pfam:PAD_M	115	273	4.2e-61	PFAM
Pfam:PAD	283	661	2.3e-169	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172098
AA Change: T289A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000130721
Gene: ENSMUSG00000025328
AA Change: T289A

Domain	Start	End	E-Value	Type
Pfam:PAD_N	14	103	3.9e-29	PFAM
Pfam:PAD_M	105	263	2.9e-69	PFAM
Pfam:PAD	268	654	5.3e-226	PFAM

Meta Mutation Damage Score

0.2733

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type III enzyme modulates hair structural proteins, such as filaggrin in the hair follicle and trichohyalin in the inner root sheath, during hair follicle formation. Together with the type I enzyme, this enzyme may also play a role in terminal differentiation of the epidermis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit alterations in coat/ hair and vibrissa morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,010,774	V875A	possibly damaging	Het
Arhgef15	A	T	11: 68,954,557	F156L	probably damaging	Het
Bdh2	T	A	3: 135,300,691	S184T	probably damaging	Het
Bmp5	A	T	9: 75,776,093	M1L	probably benign	Het
Cacfd1	T	C	2: 27,018,455	Y134H	probably damaging	Het
Camk1	G	A	6: 113,334,525	P340L	probably benign	Het
Ccdc105	A	C	10: 78,752,838	M46R	possibly damaging	Het
Cdc14a	T	C	3: 116,297,158	H424R	possibly damaging	Het
Cntfr	T	A	4: 41,663,232	T192S	possibly damaging	Het
Erbin	G	T	13: 103,834,377	S910R	probably damaging	Het
Esrp1	A	T	4: 11,357,519	V366E	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fsip2	T	A	2: 82,978,394	S1686T	possibly damaging	Het
Gata5	A	G	2: 180,334,350	L7S	probably damaging	Het
Hgf	T	A	5: 16,613,642		probably null	Het
Ift140	A	G	17: 25,098,916	E1458G	probably damaging	Het
Ift57	G	A	16: 49,760,984	G209R	probably benign	Het
Il12rb2	G	T	6: 67,361,966		probably benign	Het
Krt78	G	A	15: 101,950,923	R280C	probably damaging	Het
Lipc	A	G	9: 70,823,386	I88T	probably damaging	Het
Lrmda	G	T	14: 22,027,276	R27L	probably benign	Het
Lrrc37a	T	G	11: 103,502,097	E834A	probably benign	Het
Mmachc	C	A	4: 116,704,541	R132L	probably damaging	Het
Myo10	T	C	15: 25,714,110	Y88H	probably damaging	Het
Myo5b	G	A	18: 74,701,503	R878Q	possibly damaging	Het
Olfr1392	A	G	11: 49,294,050	H243R	probably damaging	Het
Pcdhgb4	G	T	18: 37,721,229	A226S	possibly damaging	Het
Pde4c	T	C	8: 70,746,010	V167A	probably damaging	Het
Pigr	A	G	1: 130,846,548	T422A	probably benign	Het
Pmp2	T	C	3: 10,182,482	Y49C	probably benign	Het
Prpf39	A	G	12: 65,056,274	I441V	possibly damaging	Het
Ptprs	A	G	17: 56,437,884	V284A	probably damaging	Het
Rsad1	T	C	11: 94,543,340	E354G	probably damaging	Het
Sema4b	T	A	7: 80,220,201	D412E	possibly damaging	Het
Siglecg	A	G	7: 43,408,979	I97V	probably benign	Het
Slc4a3	C	T	1: 75,554,538	R792*	probably null	Het
Slc6a20a	A	G	9: 123,637,070	C569R	probably damaging	Het
Spata19	T	C	9: 27,397,980	V59A	probably benign	Het
Sult2a3	T	A	7: 14,082,704	Y183F	probably benign	Het
Tedc1	C	T	12: 113,158,082	T194M	probably damaging	Het
Tmem63c	T	A	12: 87,075,665	N412K	probably damaging	Het
Trav5-1	T	C	14: 52,622,945	I69T	possibly damaging	Het
Trim68	T	C	7: 102,678,783	D321G	probably damaging	Het
Ttn	T	C	2: 76,865,256		probably benign	Het
Vars2	A	G	17: 35,666,713	V109A	probably damaging	Het
Vmn2r96	C	T	17: 18,598,090	P643L	probably damaging	Het
Zfpm2	G	T	15: 40,954,708	V146F	possibly damaging	Het
Znfx1	T	C	2: 167,056,599	K135R	probably benign	Het

Other mutations in Padi3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Padi3	APN	4	140803624	missense	possibly damaging	0.78
IGL00948:Padi3	APN	4	140788943	missense	possibly damaging	0.92
IGL00949:Padi3	APN	4	140788943	missense	possibly damaging	0.92
IGL01021:Padi3	APN	4	140796334	splice site	probably benign
IGL02400:Padi3	APN	4	140788868	missense	probably benign	0.00
IGL02449:Padi3	APN	4	140789712	critical splice donor site	probably null
IGL02600:Padi3	APN	4	140798156	missense	probably benign	0.15
IGL03342:Padi3	APN	4	140810598	nonsense	probably null
FR4304:Padi3	UTSW	4	140792972	critical splice donor site	probably benign
PIT4544001:Padi3	UTSW	4	140791483	missense	probably benign	0.00
R0455:Padi3	UTSW	4	140795713	missense	probably damaging	1.00
R0743:Padi3	UTSW	4	140786429	missense	probably benign	0.00
R1279:Padi3	UTSW	4	140803577	missense	probably benign	0.00
R2081:Padi3	UTSW	4	140798979	missense	probably damaging	1.00
R3016:Padi3	UTSW	4	140786587	missense	probably damaging	1.00
R3853:Padi3	UTSW	4	140791269	splice site	probably benign
R4599:Padi3	UTSW	4	140798111	missense	probably damaging	1.00
R4909:Padi3	UTSW	4	140795626	missense	probably damaging	1.00
R5370:Padi3	UTSW	4	140810538	nonsense	probably null
R5482:Padi3	UTSW	4	140795843	missense	probably damaging	0.99
R6084:Padi3	UTSW	4	140795843	missense	probably damaging	1.00
R6151:Padi3	UTSW	4	140796394	missense	probably damaging	1.00
R6277:Padi3	UTSW	4	140791161	critical splice donor site	probably null
R6343:Padi3	UTSW	4	140803508	missense	possibly damaging	0.58
R7096:Padi3	UTSW	4	140800124	missense	probably damaging	1.00
R7403:Padi3	UTSW	4	140800119	missense	probably benign
R7798:Padi3	UTSW	4	140786439	missense	probably benign
R7818:Padi3	UTSW	4	140798142	missense	possibly damaging	0.72
R8375:Padi3	UTSW	4	140798096	missense	probably damaging	1.00
R8887:Padi3	UTSW	4	140796484	nonsense	probably null
R9036:Padi3	UTSW	4	140795693	missense	probably benign	0.00
R9339:Padi3	UTSW	4	140795617	missense	probably benign	0.11
R9403:Padi3	UTSW	4	140810532	missense	probably benign
RF025:Padi3	UTSW	4	140792972	critical splice donor site	probably benign
RF032:Padi3	UTSW	4	140792972	critical splice donor site	probably benign
RF040:Padi3	UTSW	4	140792972	critical splice donor site	probably benign
RF043:Padi3	UTSW	4	140792972	critical splice donor site	probably benign
Z1176:Padi3	UTSW	4	140795671	missense	possibly damaging	0.92
Z1176:Padi3	UTSW	4	140798123	missense	not run
Z1177:Padi3	UTSW	4	140798123	missense	not run

Predicted Primers

PCR Primer
(F):5'- AGATGGTGAGTTTGCAGCCC -3'
(R):5'- GATAAGGGCCTCAAACTCCC -3'

Sequencing Primer
(F):5'- GAGTTTGCAGCCCGCCTTC -3'
(R):5'- ACAGGGTCAATTGTAGCCCTG -3'

Posted On

2018-08-29