Mutagenetix > Incidental Mutation

Incidental Mutation 'R6749:Il12rb2'

532883

Institutional Source

Beutler Lab

Gene Symbol

Il12rb2

Ensembl Gene

ENSMUSG00000018341

Gene Name

interleukin 12 receptor, beta 2

Synonyms

IL-12RB2, Ifnm, A930027I18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6749 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67291318-67376188 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

G to T at 67361966 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000010605 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018485]

AlphaFold

P97378

Predicted Effect

probably benign
Transcript: ENSMUST00000018485

SMART Domains

Protein: ENSMUSP00000010605
Gene: ENSMUSG00000018341

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Lep_receptor_Ig	28	120	6.4e-20	PFAM
FN3	137	225	2.41e0	SMART
FN3	240	320	3.4e-4	SMART
Blast:FN3	340	434	2e-40	BLAST
FN3	436	525	3.17e-4	SMART
FN3	534	622	6.45e-5	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele have defects in IFN-gamma production and cytotoxic T lymphocyte and NK cytotoxicity, develop an autoimmune/lymphoproliferative disorder associated with higher susceptibility to spontaneous tumor formation, but show reduced in vivo growth of B16 melanoma tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,010,774	V875A	possibly damaging	Het
Arhgef15	A	T	11: 68,954,557	F156L	probably damaging	Het
Bdh2	T	A	3: 135,300,691	S184T	probably damaging	Het
Bmp5	A	T	9: 75,776,093	M1L	probably benign	Het
Cacfd1	T	C	2: 27,018,455	Y134H	probably damaging	Het
Camk1	G	A	6: 113,334,525	P340L	probably benign	Het
Ccdc105	A	C	10: 78,752,838	M46R	possibly damaging	Het
Cdc14a	T	C	3: 116,297,158	H424R	possibly damaging	Het
Cntfr	T	A	4: 41,663,232	T192S	possibly damaging	Het
Erbin	G	T	13: 103,834,377	S910R	probably damaging	Het
Esrp1	A	T	4: 11,357,519	V366E	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fsip2	T	A	2: 82,978,394	S1686T	possibly damaging	Het
Gata5	A	G	2: 180,334,350	L7S	probably damaging	Het
Hgf	T	A	5: 16,613,642		probably null	Het
Ift140	A	G	17: 25,098,916	E1458G	probably damaging	Het
Ift57	G	A	16: 49,760,984	G209R	probably benign	Het
Krt78	G	A	15: 101,950,923	R280C	probably damaging	Het
Lipc	A	G	9: 70,823,386	I88T	probably damaging	Het
Lrmda	G	T	14: 22,027,276	R27L	probably benign	Het
Lrrc37a	T	G	11: 103,502,097	E834A	probably benign	Het
Mmachc	C	A	4: 116,704,541	R132L	probably damaging	Het
Myo10	T	C	15: 25,714,110	Y88H	probably damaging	Het
Myo5b	G	A	18: 74,701,503	R878Q	possibly damaging	Het
Olfr1392	A	G	11: 49,294,050	H243R	probably damaging	Het
Padi3	T	C	4: 140,795,853	T289A	possibly damaging	Het
Pcdhgb4	G	T	18: 37,721,229	A226S	possibly damaging	Het
Pde4c	T	C	8: 70,746,010	V167A	probably damaging	Het
Pigr	A	G	1: 130,846,548	T422A	probably benign	Het
Pmp2	T	C	3: 10,182,482	Y49C	probably benign	Het
Prpf39	A	G	12: 65,056,274	I441V	possibly damaging	Het
Ptprs	A	G	17: 56,437,884	V284A	probably damaging	Het
Rsad1	T	C	11: 94,543,340	E354G	probably damaging	Het
Sema4b	T	A	7: 80,220,201	D412E	possibly damaging	Het
Siglecg	A	G	7: 43,408,979	I97V	probably benign	Het
Slc4a3	C	T	1: 75,554,538	R792*	probably null	Het
Slc6a20a	A	G	9: 123,637,070	C569R	probably damaging	Het
Spata19	T	C	9: 27,397,980	V59A	probably benign	Het
Sult2a3	T	A	7: 14,082,704	Y183F	probably benign	Het
Tedc1	C	T	12: 113,158,082	T194M	probably damaging	Het
Tmem63c	T	A	12: 87,075,665	N412K	probably damaging	Het
Trav5-1	T	C	14: 52,622,945	I69T	possibly damaging	Het
Trim68	T	C	7: 102,678,783	D321G	probably damaging	Het
Ttn	T	C	2: 76,865,256		probably benign	Het
Vars2	A	G	17: 35,666,713	V109A	probably damaging	Het
Vmn2r96	C	T	17: 18,598,090	P643L	probably damaging	Het
Zfpm2	G	T	15: 40,954,708	V146F	possibly damaging	Het
Znfx1	T	C	2: 167,056,599	K135R	probably benign	Het

Other mutations in Il12rb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00584:Il12rb2	APN	6	67357692	missense	probably damaging	0.98
IGL00767:Il12rb2	APN	6	67303562	missense	possibly damaging	0.63
IGL00835:Il12rb2	APN	6	67360567	missense	probably damaging	0.99
IGL00864:Il12rb2	APN	6	67336754	missense	probably benign
IGL00965:Il12rb2	APN	6	67360577	missense	probably damaging	0.98
IGL01161:Il12rb2	APN	6	67361865	splice site	probably benign
IGL01980:Il12rb2	APN	6	67360535	missense	probably benign
IGL02246:Il12rb2	APN	6	67308956	critical splice donor site	probably null
IGL02807:Il12rb2	APN	6	67351316	missense	probably damaging	1.00
R0003:Il12rb2	UTSW	6	67316286	missense	probably damaging	1.00
R0022:Il12rb2	UTSW	6	67298919	missense	probably damaging	0.99
R0022:Il12rb2	UTSW	6	67298919	missense	probably damaging	0.99
R0079:Il12rb2	UTSW	6	67361905	missense	probably benign	0.00
R0462:Il12rb2	UTSW	6	67303610	missense	possibly damaging	0.95
R0709:Il12rb2	UTSW	6	67298904	splice site	probably benign
R0828:Il12rb2	UTSW	6	67356707	missense	probably benign
R1051:Il12rb2	UTSW	6	67356735	missense	probably benign
R1191:Il12rb2	UTSW	6	67298216	missense	possibly damaging	0.90
R1446:Il12rb2	UTSW	6	67309143	missense	probably benign
R1559:Il12rb2	UTSW	6	67356592	missense	probably benign	0.12
R1677:Il12rb2	UTSW	6	67303501	missense	probably damaging	1.00
R1689:Il12rb2	UTSW	6	67336760	missense	probably benign	0.01
R1907:Il12rb2	UTSW	6	67295286	nonsense	probably null
R1952:Il12rb2	UTSW	6	67292316	missense	probably damaging	0.99
R2048:Il12rb2	UTSW	6	67360545	missense	probably benign	0.05
R2074:Il12rb2	UTSW	6	67360552	missense	probably damaging	1.00
R2351:Il12rb2	UTSW	6	67361944	nonsense	probably null
R2358:Il12rb2	UTSW	6	67298195	missense	probably damaging	0.96
R2680:Il12rb2	UTSW	6	67354805	missense	possibly damaging	0.94
R2920:Il12rb2	UTSW	6	67360568	missense	probably damaging	0.96
R3107:Il12rb2	UTSW	6	67360798	missense	probably damaging	1.00
R4420:Il12rb2	UTSW	6	67316410	splice site	probably null
R4838:Il12rb2	UTSW	6	67309137	missense	probably damaging	1.00
R5391:Il12rb2	UTSW	6	67292420	missense	probably benign	0.24
R5532:Il12rb2	UTSW	6	67292262	missense	probably damaging	1.00
R5696:Il12rb2	UTSW	6	67295278	missense	possibly damaging	0.94
R5704:Il12rb2	UTSW	6	67292213	missense	possibly damaging	0.53
R5891:Il12rb2	UTSW	6	67360690	missense	probably damaging	0.97
R6482:Il12rb2	UTSW	6	67356686	missense	probably damaging	1.00
R6813:Il12rb2	UTSW	6	67292374	missense	probably damaging	0.98
R6957:Il12rb2	UTSW	6	67292652	missense	possibly damaging	0.60
R7312:Il12rb2	UTSW	6	67356633	missense	probably benign	0.29
R7361:Il12rb2	UTSW	6	67303466	missense	possibly damaging	0.48
R7813:Il12rb2	UTSW	6	67356651	missense	possibly damaging	0.72
R7992:Il12rb2	UTSW	6	67351327	nonsense	probably null
R8422:Il12rb2	UTSW	6	67360816	missense	probably benign	0.20
R8752:Il12rb2	UTSW	6	67351281	missense	probably damaging	1.00
R9648:Il12rb2	UTSW	6	67356603	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- GTGCAGCCATTATGCTTCATG -3'
(R):5'- CCCAAGATGGTTCACTGAGATGG -3'

Sequencing Primer
(F):5'- AGCCATTATGCTTCATGTTTCTTAGG -3'
(R):5'- GTTCACTGAGATGGGAGGC -3'

Posted On

2018-08-29