Incidental Mutation 'R6749:Camk1'
ID532884
Institutional Source Beutler Lab
Gene Symbol Camk1
Ensembl Gene ENSMUSG00000030272
Gene Namecalcium/calmodulin-dependent protein kinase I
SynonymsD6Ertd263e, CaMKIalpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6749 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location113334124-113343984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113334525 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 340 (P340L)
Ref Sequence ENSEMBL: ENSMUSP00000032409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032406] [ENSMUST00000032409] [ENSMUST00000136263] [ENSMUST00000155543] [ENSMUST00000204834]
Predicted Effect probably benign
Transcript: ENSMUST00000032406
SMART Domains Protein: ENSMUSP00000032406
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Pfam:OGG_N 25 141 4e-38 PFAM
ENDO3c 146 316 4.84e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032409
AA Change: P340L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032409
Gene: ENSMUSG00000030272
AA Change: P340L

DomainStartEndE-ValueType
S_TKc 20 276 5.03e-111 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 358 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136263
SMART Domains Protein: ENSMUSP00000144792
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Pfam:OGG_N 25 130 3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155543
SMART Domains Protein: ENSMUSP00000117749
Gene: ENSMUSG00000030272

DomainStartEndE-ValueType
Pfam:Pkinase 8 162 1.4e-45 PFAM
Pfam:Pkinase_Tyr 9 162 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204834
SMART Domains Protein: ENSMUSP00000144905
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Pfam:OGG_N 25 134 1.2e-27 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium/calmodulin-dependent protein kinase I is expressed in many tissues and is a component of a calmodulin-dependent protein kinase cascade. Calcium/calmodulin directly activates calcium/calmodulin-dependent protein kinase I by binding to the enzyme and indirectly promotes the phosphorylation and synergistic activation of the enzyme by calcium/calmodulin-dependent protein kinase I kinase. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,774 V875A possibly damaging Het
Arhgef15 A T 11: 68,954,557 F156L probably damaging Het
Bdh2 T A 3: 135,300,691 S184T probably damaging Het
Bmp5 A T 9: 75,776,093 M1L probably benign Het
Cacfd1 T C 2: 27,018,455 Y134H probably damaging Het
Ccdc105 A C 10: 78,752,838 M46R possibly damaging Het
Cdc14a T C 3: 116,297,158 H424R possibly damaging Het
Cntfr T A 4: 41,663,232 T192S possibly damaging Het
Erbin G T 13: 103,834,377 S910R probably damaging Het
Esrp1 A T 4: 11,357,519 V366E probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 T A 2: 82,978,394 S1686T possibly damaging Het
Gata5 A G 2: 180,334,350 L7S probably damaging Het
Hgf T A 5: 16,613,642 probably null Het
Ift140 A G 17: 25,098,916 E1458G probably damaging Het
Ift57 G A 16: 49,760,984 G209R probably benign Het
Il12rb2 G T 6: 67,361,966 probably benign Het
Krt78 G A 15: 101,950,923 R280C probably damaging Het
Lipc A G 9: 70,823,386 I88T probably damaging Het
Lrmda G T 14: 22,027,276 R27L probably benign Het
Lrrc37a T G 11: 103,502,097 E834A probably benign Het
Mmachc C A 4: 116,704,541 R132L probably damaging Het
Myo10 T C 15: 25,714,110 Y88H probably damaging Het
Myo5b G A 18: 74,701,503 R878Q possibly damaging Het
Olfr1392 A G 11: 49,294,050 H243R probably damaging Het
Padi3 T C 4: 140,795,853 T289A possibly damaging Het
Pcdhgb4 G T 18: 37,721,229 A226S possibly damaging Het
Pde4c T C 8: 70,746,010 V167A probably damaging Het
Pigr A G 1: 130,846,548 T422A probably benign Het
Pmp2 T C 3: 10,182,482 Y49C probably benign Het
Prpf39 A G 12: 65,056,274 I441V possibly damaging Het
Ptprs A G 17: 56,437,884 V284A probably damaging Het
Rsad1 T C 11: 94,543,340 E354G probably damaging Het
Sema4b T A 7: 80,220,201 D412E possibly damaging Het
Siglecg A G 7: 43,408,979 I97V probably benign Het
Slc4a3 C T 1: 75,554,538 R792* probably null Het
Slc6a20a A G 9: 123,637,070 C569R probably damaging Het
Spata19 T C 9: 27,397,980 V59A probably benign Het
Sult2a3 T A 7: 14,082,704 Y183F probably benign Het
Tedc1 C T 12: 113,158,082 T194M probably damaging Het
Tmem63c T A 12: 87,075,665 N412K probably damaging Het
Trav5-1 T C 14: 52,622,945 I69T possibly damaging Het
Trim68 T C 7: 102,678,783 D321G probably damaging Het
Ttn T C 2: 76,865,256 probably benign Het
Vars2 A G 17: 35,666,713 V109A probably damaging Het
Vmn2r96 C T 17: 18,598,090 P643L probably damaging Het
Zfpm2 G T 15: 40,954,708 V146F possibly damaging Het
Znfx1 T C 2: 167,056,599 K135R probably benign Het
Other mutations in Camk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Camk1 APN 6 113336211 missense probably benign 0.00
IGL01063:Camk1 APN 6 113338372 missense probably damaging 0.98
R0415:Camk1 UTSW 6 113341891 nonsense probably null
R0944:Camk1 UTSW 6 113338391 missense probably damaging 1.00
R2342:Camk1 UTSW 6 113341981 splice site probably benign
R5646:Camk1 UTSW 6 113339340 missense probably damaging 0.99
R6734:Camk1 UTSW 6 113334384 missense probably benign 0.00
R7015:Camk1 UTSW 6 113341926 missense probably benign
R7041:Camk1 UTSW 6 113339514 missense probably benign 0.03
R7355:Camk1 UTSW 6 113338346 missense probably damaging 1.00
R7575:Camk1 UTSW 6 113338364 missense probably damaging 1.00
R7686:Camk1 UTSW 6 113336197 missense probably damaging 1.00
R7748:Camk1 UTSW 6 113340328 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATCCATGGCCCTAGAGCTTG -3'
(R):5'- GTAACACCTTACAGAGTCGGG -3'

Sequencing Primer
(F):5'- CCCTAGAGCTTGGGGGTG -3'
(R):5'- TTACAGAGTCGGGGAGCCTC -3'
Posted On2018-08-29